Original Articles |
1 Angelo Bianchi Bonomi Hemophilia and Thrombosis Center, University of Milan, Department of Medicine and Medical Specialities, IRCCS Maggiore Hospital, Mangiagalli and Regina Elena Foundation, Luigi Villa Foundation, Milan, Italy
2 Department of Pediatric Hematology, Dokuz Eylül University Faculty of Medicine, Balçova, Izmir, Turkey
3 Department of Internal Medicine, Johann Wolfgang Goethe University Hospital, Frankfurt am Main, Germany
Correspondence: Flora Peyvandi, Angelo Bianchi, Bonomi Hemophilia and Thrombosis, Centre, University of Milan, Department of Medicine and Medical Specialities, IRCCS Maggiore Hospital, Mangiagalli and Regina Elena Foundation, Luigi Villa Foundation, Milan, Italy. E-mail:flora.peyvandi{at}unimi.it
Background: In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts.
Design and Methods: In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay.
Results: In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies.
Conclusions: In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.
Key words: ADAMTS13, in vitro expression study, mRNA expression, nonsense-mRNA decay.
This article has been cited by other articles:
![]() |
M. Galbusera, M. Noris, and G. Remuzzi Inherited thrombotic thrombocytopenic purpura Haematologica, February 1, 2009; 94(2): 166 - 170. [Full Text] [PDF] |
||||