Haematologica
HOME HELP FEEDBACK TABLE OF CONTENTS ARCHIVE SUBSCRIPTIONS
 QUICK SEARCH:   [advanced]


     


Haematologica, Vol 92, Issue 10, 1319-1326 doi:10.3324/haematol.11556
Copyright © 2007 by Ferrata Storti Foundation
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De Franceschi, L.
Right arrow Articles by Iolascon, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De Franceschi, L.
Right arrow Articles by Iolascon, A.

Red Cell Disorders

K-CL co-transport plays an important role in normal and ß thalassemic erythropoiesis

Lucia De Franceschi, Luisa Ronzoni, Maria Domenica Cappellini, Flora Cimmino, Angela Siciliano, Seth L. Alper, Veronica Servedio, Christian Pozzobon, Achille Iolascon

From the Department of Clinical and Experimental Medicine, Section of Internal Medicine, University of Verona, Italy (LDF, AS, CP); Department of Internal Medicine, University of Milano, Fondazione Policlinico Mangiagalli, Regina Elena, IRCCS, Milano; Italy (LR, MDC); Department of Biochemistry and Medical Biotechnology, University Federico II, CEINGE Napoli, Italy (FC, VS, AI); Molecular and Vascular Medicine and Renal Units, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, USA (SLA)

Correspondence: Maria Domenica Cappellini, MD, Department of Internal Medicine, University of Milano, IRCCS, Via F. Sforza, 35, 20122 Milano, Italy. E-mail: maria.cappellini{at}unimi.it


    ABSTRACT
 TOP
 ABSTRACT
 Design and Methods
 Results
 Discussion
 References
 
Background and Objectives: Cell volume changes are hallmarks of both cell maturation and apoptosis, and are paralleled by modulation of membrane ion transport pathways. We evaluated the possible role of K-Cl co-transport (KCC) in both normal and ß-thalassemic erythropoiesis in vitro.

Design and Methods: We studied the effects of the KCC inhibitor, DIOA, on cell proliferation and differentiation, on expression of KCC mRNA and polypeptides, and on expression of cell cycle and apoptosis genes in in vitro liquid-cultures of CD34+ cells from normal and ß-thalassemic subjects.

Results: ß-thalassemic erythroid precursors showed increased abundance of KCC1-3 mRNA and of KCC polypeptides in late erythropoiesis. DIOA markedly modified the composition of normal erythroid precursors, promoting differentiation and arrest at the polychromatic erythroblast stage and resulting in a precursor distribution profile similar to that of untreated ß-thalassemic cells. DIOA up-regulated cyclin-D mRNA levels in late erythropoiesis in both cell models, paralleling changes in the percentage of S-phase-cells. Caspase-3 activity in late erythropoiesis declined to similar degrees in both cell models. DIOA did not modify caspase-3 or -8 mRNA levels.

Interpretation and Conclusions: Ineffective erythropoiesis of in vitro cultured ß-thalassemic cells is likely related to impaired cell maturation. KCC activity appears to contribute to erythroid cell growth during late erythropoiesis.

Key words: erythroid precursors, DIOA, cyclin-D, p21.

Erythropoiesis is a complex multistage process characterized by differentiation of pluripotent hematopoietic progenitors to reticulocytes and then to mature red cells. Although understanding of the mechanisms involved in the maturation of normal erythroid precursors has progressed in the last decade, much remains unknown about erythroid maturation in inherited erythroid diseases. ß thalassemia is a congenital red cell disorder characterized by the absence or reduced synthesis of hemoglobin ß globin chains. Despite extensive knowledge of the molecular defects causing ß thalassemia, less is known about the major factors contributing to ß thalassemic anemia: the reduction of ß thalassemic red cell life-span and ineffective erythropoiesis.14

Ineffective erythropoiesis has been shown in ß thalassemia in vivo by ferrokinetic assays, suggesting a block in erythroid precursors and a precocious cell death in bone marrow.25 Recently, Mathias et al. showed that ineffective erythropoiesis in the bone marrow precursors of patients with ß thalassemia major is associated with progressively increased apoptosis of polychromatophilic normoblasts of late erythropoiesis and seems to be related to hemoglobin chain synthesis.6 However, the mechanisms underlying apoptosis of ß thalassemic erythroid precursors and the developmental kinetics of ß thalassemic ineffective erythropoiesis need further investigation.

Since cell volume change is one of the hallmarks of cell progression towards apoptosis or proliferation, the modulation of ion transport pathways paralleling these cellular events has been proposed to act as a second or even third messenger.7 In addition, changes in cell K+ content have been described in mouse erythroleukemia (MEL) cells during the transition from proerythroblasts to young reticulocytes, as well as in leukemic cells exposed to glucocorticoid treatment,8,9 suggesting the involvement of pathways regulating cell K+ content in the maturation of erythroid precursors.

The K-Cl co-transport (KCC) family plays a crucial role in red cell volume regulation and intracellular ion homeostasis.1013 Multiple KCC gene products (KCC1, KCC3 and KCC4) have been identified in various non-neuronal cell types.1017 Recently, KCC1 and KCC3 have been shown to participate in cellular proliferation events in cervical cancer cells and in KCC3-transfected NIH/3T3 cells, respectively.10,11 In red cells, the KCC function is modulated by cell swelling, cell acidification, reduced cell magnesium (Mg) content, membrane oxidative damage and cell age.3,1620 Abnormal activation of KCC has been reported in sickle red cells, in ß thalassemic syndromes and in pathological erythrocytes containing positively charged hemoglobin variants in ß6 and ß7.3,18,19,21 Studies in diseased red cells have shown that KCC plays a crucial role in red cell volume regulation, contributing to red cell water and K+ loss and generation of dehydrated red cells.3,20,22 Recently KCC1, 3 and 4 have been described in human reticulocytes and in human erythroid precursors from sickle cell subjects.14,15 Although the activity of KCC has been partially characterized in circulating erythrocytes, the role of KCC in cell volume regulation during cell growth in normal and ß thalassemic erythroid precursors is still unknown.

Here, we evaluated the expression of KCC1, KCC3 and KCC4 mRNA and KCC polypeptides in normal and in ß thalassemic erythroid precursors. We then asked whether KCC might be important in erythroid cell proliferation in both normal and ß thalassemic cells. We evaluated the effects of the KCC inhibitor [(dihydroindoenyl)oxy]alkanoic acid (DIOA)3,23 on cell proliferation and differentiation, and on expression of KCC mRNA and protein, expression of the cell cycle genes cyclin-D (CycD) and p21 (P21), and on expression of the apoptosis genes caspase-3 (Casp3) and caspase-8 (Casp8).


    Design and Methods
 TOP
 ABSTRACT
 Design and Methods
 Results
 Discussion
 References
 
Cell culture
Peripheral blood from normal volunteers and from homozygous 0cod39) ß-thalassemia patients was collected into heparinized tubes, after informed consent had been obtained. Blood from ß-thalassemic patients was collected before their routine transfusion according to the guidelines established by the local Ethics Committee for studies involving human subjects. We analyzed 20 separate individuals’ cultured cells from normal subjects and 20 separate individuals’ cultured cells from ten ß-thalassemic patients. Light-density mononuclear cells were obtained by centrifugation on Lymphoprep (Nycomed Pharma, Oslo, Norway) density gradient, as previously described. The CD34+ cells were positively selected by anti-CD34tagged magnetic beads (Mini-MACS columns; Miltenyi Biotech, Auburn, CA, USA) according to the manufacturer’s protocol. The recovery was more than 90% CD34+ cells, as determined by flow cytometry. CD34+ cells were grown at a density of 105 cells/mL in {alpha}-minimal essential medium ({alpha}-MEM; GIBCO, Grand Island, NY, USA) supplemented with 100 U/mL penicillin-streptomycin, 2 mmol/L L-glutamine, 10–6 mol/L hydrocortisone, 10–3 g/L nucleotide, 25x10–3 mg/L gentamycin, 10–4 mol/L 2-mercaptoethanol, 1% deionized bovine serum albumin [BSA] (all from Sigma, St Louis, MO, USA), 30% fetal bovine serum (FBS, GIBCO) and 1 µg/mL cyclosporine A (Sigma). The following recombinant cytokines were added to the media: 3 U/mL recombinant human (rHu) erythropoietin (rHuEPO, Janssen-Cilag, Milan, Italy), 20 ng/mL rHu stem cell factor (SCF, PeproTech, London, UK), 10 ng/mL rHu interleukin-3 (IL-3, PeproTech).

DIOA was used to inhibit KCC activity. The DIOA was dissolved in DMSO to generate a stock solution. This stock solution was further diluted with the cultured medium, and added to the cells in culture medium at the final concentration of 10 µM or 100 µM as specified in the text or figure legends.3,18, 23 Experiments, which were carried out in parallel cell cultures and to which only DMSO diluted as described above but without DIOA was added, indicated no effect on cell growth (data not shown). Cells were incubated at 37°C in 5% CO2 for 14 days with renewal of the medium after 7 days of culture. Cell samples were collected on days 7 and 14 for cell counting and determination of cell viability.

Phenotypic analysis of cultured cells
Cell morphology was analyzed on cytospin smears stained with May-Grünwald-Giemsa. Benzidine staining was used to determine hemoglobin-containing cells.

The erythroid cell antigen profile was analyzed with the Becton Dickinson FACScan flow cytometer using Cell Quest software after gating on viable cells, labeled with the following fluorophor-conjugated antibodies: phycoerythrin (PE)-conjugated anti-CD34, perCP-conjugate anti-CD45 (Becton Dickinson, San José, CA, USA) and fluorescein isothiocyanate (FITC)-conjugated anti-glycophorin A (DakoCytomation, Glostrup, Denmark).

Determination of cell cycle stage by fluorescence-activated cell sorting (FACS)
Cellular DNA content was determined by FACS analysis after staining with propidium iodide (PI; Sigma, St Louis, MO, USA). Cells (106) were harvested at day 7 and 14 of culture, fixed by slow addition of cold 70% ethanol to a volume of 500 µL, and stored at 4°C. The fixed cells were stained in 1 mL of 20 µg/mL PI, 1 mg/mL RNAase (Sigma), Nonidet P40 1% in 1X phosphate-buffered saline for 1 hour at room temperature. Next, 5x105 cells were evaluated, and the proportion of cells in S-phase was estimated using the MODFIT cell cycle analysis program (Verity Software House, Topshem, ME, USA) on a FACScan flow cytometer (Becton Dickinson).10

Real-time reverse transciptase-polymerease chain reaction (RT-PCR)
Real-time RT-PCR was performed for the following genes: KCC1, KCC3, KCC4, CycD, P21, Casp3 and Casp8. cDNA was generated from total RNA samples with the Reverse Transcription Reagents kit (Invitrogen). Four micrograms total RNA from each sample were incubated at 25°C for 10 min and reverse-transcribed at 42°C for 50 min, using random primers. Real-time SYBR green RT-PCR was performed with the ABI PRISM 7900HT (Applied Biosystems). The following primers (designed using Primer Express Software version 2.1; Applied Biosystems) were used:


KCC1: Fov: ACA GCC CCA ACC TTA CGA C
Rev: CTC CAC GAT GTCACC CTT CT
KCC3: Fov: GATGATGGAACAAAGGTCCCAG;
Rev: TTCACCAATTGTGCCTCTCTGT
KCC4: Fov GTATCACTTGCGCATCAGCG;
Rev GTCCTCTCGTAGGTGAAAGCAGAT
CycD: Fov: AGA CCT TTT GGT CCC TCT GT
Rev: AGC TTC GAT CTG CTC CTG AC
P21: Fov: AGT GGA CAG CGA GCA GCT
Rev: CCG TGG GAA GGT AGA GCTT
Casp3: Fov: TGTGGAATTGATGCGTGATGTT;
Rev: TCACCATGGCTCAGAAGCAC
Casp8: Fov: ACACCAGGCAGGGCTCAA;
Rev: CTGGCACTGGCTGTTTGCT
ß-actin: Fov: CGTGCTGCTGACCGAGG
Rev: GAAGGTCTCAAACATGATCTGGGT

The reaction mixtures (25 µL) contained 5 µL of cDNA solution diluted 10-fold, and 20 µL PCR master mix (PCR SYBER Green master mix, Applied Biosystems) containing 0.6 µM of each primer. The cycling temperature was 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 10 min. The ABI PRISM 7900HT instrument (Applied Biosystems) determined the threshold cycle (Ct) representing the cycle number at which fluorescence intensity significantly exceeded background fluorescence. Melting curve analysis was also performed after PCR amplification to verify the absence of primer dimer in the PCR products (95°C for 15 sec, 60°C for 15 min, 95°C for 15 sec). All PCR reactions were performed in duplicate. The target expression values were normalized to the expression value of ß-actin, used as a housekeeping gene. Since we focused on the effects of cell growth on expression of these genes, we considered the ratio between the mean values of normalized gene expression at day 14 and at day 7 of culture (14d/7d) in both normal and ß-thalassemic cells.

KCC protein expression and cell cation content
KCC protein expression was evaluated by immunoblot analysis using immunospecific anti-KCC-COOH terminus antibody in cells at the different differentiation time points studied;22,24 anti-actin (Sigma Chemical Co, St Louis, MO, USA) was used as the loading control. Cells were washed in a buffer containing 150 mM choline chloride, 1 mM MgCl2, and 10 mM Tris-MOPS, pH 7.4 at 4°C (CWS). The cells were lysed in ice cold Phosphate Lysis Buffer (LB: 5 mM Na2HPO4 pH 8.0, containing: protease inhibitor cocktail tablets (Roche, Indianapolis, IN, USA), and 3 mM benzamidine (final concentration). The cell Na+ and K+ content was determined by atomic absorption spectrometry (ANALYST 2000, Perkin-Elmer) of cells washed in CWS buffer. Protein concentration was measured by Lowry’s assay.25

Determination of caspase-3 activity
Caspase-3 activity was assayed in cells harvested at day 7 and 14 of culture and lysed by freeze-thawing. The cell lysate was centrifuged at 200 g for 5 minutes and the supernatant assayed for caspase-3 activity using the ENZCHEK caspase-3 assay kit with a DEVD-AMC substrate (Molecular Probes, Eugene, OR, USA) according to the manufacturer’s instructions.26

Statistical analysis
Comparisons of separate variables were performed using the two-tailed Student’s t test. Comparisons involving more than two groups were performed by one-way ANOVA with Tukey’s test for post hoc comparison of means.


    Results
 TOP
 ABSTRACT
 Design and Methods
 Results
 Discussion
 References
 
Effects of KCC pharmacological inhibition on erythroid cell proliferation
We studied erythroid precursors derived by in vitro liquid-culture of CD34+ cells from peripheral blood of normal and ß thalassemic subjects. As shown in Figure 1A, the morphology of control and ß thalassemic cells was compatible with erythroid differentiation, as also supported by FACS analysis of cellular glycophorin-A expression (data not shown). We observed an increase in cell number at day 14 of culture only in control cells, whereas in ß thalassemic patients, the total number of cells significantly decreased at day 14 of culture, suggesting the presence of ineffective erythropoiesis (Figure 1B). In addition, exposure to the KCC inhibitor – DIOA, significantly reduced the number of total cells proceeding towards maturation in both control and ß thalassemic cell cultures at day 14 (Figure 1A and 1B). Since the effect of DIOA on cell number was concentration dependent (Figure 1B), we decided to use 10 µM DIOA in subsequent experiments based on previous in vitro pharmacological studies conducted in different cell lines, in which DIOA at similar concentrations maintained KCC inhibition.10,11,18


Figure 10921319
View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. A. Morphology of erythroid precursors derived by in vitro liquid-culture of CD34+ cells isolated from peripheral blood of normal and ß thalassemic (ß thal) individuals in the absence and presence of the KCC inhibitor, [(dihydroindenyl)oxy] alkanoic acid (DIOA)(10 µM). Cytospin preparations of cells were stained with May-Grünwald-Giemsa and benzidine. Cells were imaged under oil at 10x magnification using a PlanFluor objective with 1.30 numeric aperture on a Nikon Eclipse 80i microscope (Tokyo, Japan). Images were captured with a Nikon DS-5M camera and processed with Digital Slide DS-L1 (Nikon) and Adobe Photoshop 6.0 (Adobe Systems, San José, CA, USA). B. Effects of DIOA 10 µM (pink squares) and 100 µM (green triangles) on total cell numbers of control cells (blue squares). C. Effects of DIOA 10 µM (pink squares) and 100 µM (green triangles) on the total number of ß thalassemic cells (blue circles). Cell viability was monitored by trypan-blue exclusion (0.08%). Data are presented as means ±SD (n=10); *p<0.05 compared to untreated cells; °p<0.05 compared to day 7 of culture; §p<0.05 untreated ß thalassemic vs untreated control cells.

 
We next evaluated cell population composition at the different time points studied. At day 7 the control cell population comprised 77.5±9.8% (n=10) of proerythroblasts, whereas at day 14, 86.2±2.1% (n=10) of cells were orthochromatic normoblasts and mature erythrocytes (Table 1). The cell populations in ß thalassemic patients at day 14 differed from those in their control counterparts. A large proportion of the ß thalassemic cells were polychromatophilic erythroblasts, possibly related to a block of cell proliferation shifting towards ineffective erythropoiesis (Table 1). The presence of the KCC inhibitor, DIOA, markedly modified the proliferation profile of control cells, which at day 14 showed a differentiation block somewhat similar to that observed in untreated ß thalassemic cells, suggesting that KCC inhibition might contribute to ineffective erythropoiesis (Table 1). In ß thalassemic cell cultures, DIOA further amplified the cell proliferation block, as supported by the increase in the basophilic erythroblast population (Table 1).


View this table:
[in this window]
[in a new window]
[Download PPT slide]
 
Table 1. Effects of the KCC inhibitor, DIOA, on the cell population composition of normal and ß-thalassemic precursors.

 
KCC expression and cell cation content in normal and ß thalassemic erythroid cultured cells
We next asked whether KCC1, KCC3 and KCC4 genes were modulated during maturation of erythroid cell precursors. In both control and ß thalassemic cells we measured the expression of KCC1, KCC3 and KCC4 genes at days 7 and 14 of culture in the presence and absence of the KCC inhibitor DIOA. During cell growth, KCC1 and KCC3 mRNA levels were higher in ß thalassemic cells than in controls, whereas KCC4 mRNA levels were lower in ß thalassemic cells than in controls (Figure 2A). These data suggest that the KCC1 and KCC3 genes are up-regulated in ß thalassemic erythroid precursors; we did not evaluate the contribution of KCC1 splice variants to total KCC1 gene expression.14 In the presence of the KCC inhibitor DIOA, KCC1 mRNA levels were up-regulated in both normal and ß thalassemic cells, whereas KCC3 mRNA levels were significantly reduced in both normal and ß thalassemic cells. In contrast, KCC4 mRNA level was unchanged in control cells but up-regulated in ß thalassemic cells treated with DIOA (Figure 2A). These data suggest that the pharmacological inhibition of KCC modulates KCC1-KCC3 gene expression in both cell models, while KCC4 gene expression is affected only in ß thalassemic cells.


Figure 20921319
View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. A. Effect of cell growth on semi-quantitative RT-PCR expression profiles of KCC1, KCC3, KCC4 in normal (black bar; controls) and ß thalassemic erythroid precursors (light gray bar; ß thal cells). Also shown are the effects of the KCC inhibitor DIOA (10 µM), on KCC1, KCC3 and KCC4 gene expression in normal (gray bar; controls) and ß thalassemic erythroid precursors (white bar; ß thal) during cell growth. Data are presented as the ratio between the mean values of normalized gene expression at day 14 and at day 7 of culture (14d/7d) in both normal and ß-thalassemic cells; *p<0.05 compared to untreated cells; °p<0.05 compared to control cells (n=10). B. Immunoblot analysis of KCC protein expression in normal and ß thalassemic erythroid precursors during maturation (7 day and 14 days: 7d and 14 d) in the presence and absence of the KCC inhibitor DIOA (10 µM). Expression of actin was used as a loading control. Representative of six independent experiments with similar results. C. Cell Na+ and K+ contents in normal (controls) and ß thalassemic erythroid (ß thal) precursors during maturation. Data are presented as means±SD (n=6); *p<0.05 compared to untreated cells; {ddagger}p<0.05 compared to baseline.

 
We evaluated KCC polypeptide expression by immunoblot analysis with anti-KCC-COOH terminus antibody, which detects all three KCC polypeptide gene products. KCC protein levels were significantly higher in ß thalassemic cells than in controls after both 7 days and 14 days of culture (Figure 2B). Moreover, DIOA treatment increased KCC protein abundance in ß thalassemic cells, reflecting up-regulation of mRNA levels of two of the three KCC genes studied (Figure 2A–B).

In view of the observed changes in KCC mRNA and protein levels, we next measured cellular Na+ and K+ contents during differentiation in both control and ß thalassemic cells. At day 7, cell Na+ content was slightly higher in ß thalassemic cells than in normal control cells (Figure 2C). At day 14, cell Na+ content decreased to similar statistically indistinguishable extents in both cell models (Figure 2C). At day 7, cell K+ content was similar in ß thalassemic cells and in normal controls. However, by day 14, cell K+ content increased in both cell types compared to day 7 values, although the ß thalassemic cell K+ content increased to a much smaller degree, and was significantly lower than in normal cells (Figure 2C).

In the presence of the KCC inhibitor – DIOA, cell Na+ content at day 7 was markedly lower in both cell types than in untreated counterpart cultures. By day 14, in the presence of DIOA, cell Na+ content had declined still further in control cells, and remained lower than that in untreated control cells. In contrast the Na+ content of untreated cells at day 14 remained essentially unchanged, and was similar to that of untreated ß thalassemic cells (Figure 2C). K+ content of control DIOA-treated cells at day 7 was slightly higher than that of untreated control cells, while at day 14 it was significantly lower than that of untreated control cells, reaching values similar to those observed in untreated ß thalassemic cells tested at the same time (Figure 2C). In ß thalassemic cells, the KCC inhibitor DIOA did not significantly change cell K+ content at day 7 compared to untreated cells, whereas cell K+ content at day 14 was slightly increased compared to that of untreated cells (Figure 2C).

Effects of pharmacological inhibition of KCC on cell-cycle markers
Cell–cycling was evaluated by FACS-analysis, measuring the proportion of cells in S-phase. Quantitative RT-PCR was used to measure mRNA levels of CycD and P21 in control and ß thalassemic cells during cell growth in the absence and presence of the KCC inhibitor, DIOA. In untreated cells, the CycD mRNA level was down-regulated in ß thalassemic cells compared to the level in normal control cells, but the P21 mRNA level was 7 fold up-regulated in ß thalassemic cells (Figure 3A). With chronic exposure to DIOA, CycD was up-regulated in both cell models (Figure 3A), in agreement with the reduction in the proportion of S-phase cells (control + DIOA 96±1% vs control untreated 140±5%; ß thal + DIOA 43±2% vs 63±3% ß thal untreated; n=6; p<0.05). In contrast, P21 gene expression in the presence of DIOA was greatly up-regulated in control cells, but substantially down-regulated in ß thalassemic cells (Figure 3A).


Figure 30921319
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. A. Effect of cell growth on quantitative RT-PCR expression profiles of CycD, P21, Casp3 and Casp8 in normal (black bars) and ß thalassemic erythroid precursors (light bars) during maturation. Also shown are mRNA expression profiles of CycD, P21, Casp3 and Casp8 in the presence of the KCC inhibitor, DIOA (10 µM), in normal (black bars) and ß thalassemic erythroid precursors (light bars) during maturation. Data are presented as the ratio between the mean values of normalized gene expression at day 14 and that at day 7 of culture (14d/7d) in both normal and ß-thalassemic cells; *p<0.05 compared to untreated cells;°p<0.05 compared to control cells (n=8). B. Caspase-3 activity in normal (controls) and ß-thalassemic (ß thal) erythroid precursors at 7 and 14 days during maturation in the absence and presence of the KCC inhibitor DIOA (10 µM), *p<0.05 compared to untreated cells.

 
Effects of pharmacological inhibition of KCC on cell apoptosis
Caspase-3 and caspase-8 are important in cell apoptosis. Although caspase-3 plays a role in apoptosis in most cells, caspase-3 activation in early-stage erythropoiesis is followed by declining activity in late-stage erythropoiesis. Recent knockdown experiments failed to demonstrate a pro-apoptotic role of caspase-3 in human erythropoiesis, but supported its novel and important role in the enucleation process.26 The role of caspase-3 in apoptosis and enucleation has not been reported in mouse erythropoiesis.26,27

In control cells, Casp3 gene expression did not change significantly during cell proliferation with or without DIOA. In ß thalassemic cells, Casp3 gene expression greatly exceeded that in control cells during cell proliferation and it was unaffected by DIOA treatment (Figure 3A). Since caspase-3 activity may not reflect modulation of Casp3 gene expression, we measured caspase-3 activity in both control and ß thalassemic cells at days 7 and 14 of cell differentiation. Caspase-3 activity was similar in both cell models and significantly decreased during cell differentiation in both control and ß thalassemic cells. DIOA treatment reduced caspase-3 activity observed at day 7 in both cell models compared to the activity in untreated cells (Figure 3B).

Casp8 mRNA levels in ß thalassemic cells were higher than in control cells. DIOA treatment further induced Casp8 gene expression in both cell types (Figure 3A).


    Discussion
 TOP
 ABSTRACT
 Design and Methods
 Results
 Discussion
 References
 
In the present study, we showed that liquid cultures of differentiating erythroid precursors derived from CD34+ peripheral blood cells of ß thalassemic subjects mimic the ineffective erythropoiesis characteristic of ß thalassemia major (Figure 1, Table 1). In late stages of in vitro erythropoiesis, we observed that ß thalassemic precursors are mainly represented by polychromatophilic erythroblasts, suggesting a block of cell proliferation contributing to an in vitro correlate of ineffective erythropoiesis (Table 1).

Since cell volume changes are hallmarks of both cell maturation events and cell apoptosis and are paralleled by modulation of membrane ion transport pathways,28 we evaluated the possible role of KCC in both normal and ß thalassemic erythropoiesis in vitro. KCC activity is involved in cell volume and K+ regulation in both normal and diseased red cells, such as ß thalassemic erythrocytes.3 Recently, KCC1 and KCC3 gene products have been reported to play important roles in cell proliferation, growth, and associated events in diverse cell lines.10,11 In human erythroid precursors the expression of KCC1 splicing variants was found to differ in cells from sickle cell anemia patients compared to red cells from normal subjects.14,15 In ß thalassemic erythroid precursors, the increased abundance of KCC1 and KCC3 mRNA and of KCC polypeptides in the late phase of erythropoiesis indicates that KCC expression is modulated during ß thalassemic erythroid maturation and that KCC activity is likely mediated principally by KCC1 and KCC3 (Figure 2). The relative role of reduced KCC3 and increased KCC4 in differentiation of ß thalassemic erythroid precursors remains unclear. The pharmacological inhibition of KCC activity affects cell growth of both normal and ß thalassemic cells.

The presence of the KCC inhibitor, DIOA, during differentiation markedly modified the composition of normal erythroid precursors in the late phase of erythropoiesis. The modified cell profile was characterized by: (i) reduction in the total number of cells; (ii) accumulation of polychromatic erythroblasts and (iii) a reduction in the proportion of S-phase cells, indicating an arrest of cell proliferation at the polychromatic erythroblastic stage similar to that observed in untreated ß thalassemic cells (Figure 1, Table 1). In addition, DIOA increased KCC1 mRNA levels in both control cells and ß thalassemic precursors, whereas KCC4 mRNA was up-regulated and KCC3 mRNA was down-regulated only in ß thalassemic precursors (Figure 2A). The prolonged inhibition of KCC by DIOA during erythropoiesis was associated with a significant reduction in cell K+ content at day 14 in control cells, reaching values similar to those in ß thalassemic cells (Figure 2C). However, the changes in cell composition, with a block in cell growth caused by DIOA, might also have contributed to the reduction of cell K+ content compared to that observed in untreated control cells. Thus, in normal erythroid precursors, pharmacological inhibition of KCC activity induces ineffective erythropoiesis with arrested cell expansion similar to that occurring ß thalassemic cells, indicating that KCC plays an important role in erythroid maturation.

Cell growth is tightly regulated by cell cycle regulatory molecules, including cyclins, cyclin-dependent kinases (CDK) and CDK inhibitors (Cki). In the current study we evaluated CycD expression. In the presence of DIOA, CycD mRNA levels were increased in both normal and ß thalassemic precursors in late phase erythropoiesis. This effect paralleled changes in the percentage of S-phase cells, and supports a role of KCC in the progression of cell growth and differentiation during erythropoiesis.

Although P21 gene expression increases over time in colonies of all hematopoietic lineages, p21 protein levels increase only in certain cell lineages during cell growth (i.e. megakaryocytes and monocytes-macrophages).29 Our data confirmed up-regulation of P21 gene expression in both normal and ß thalassemic precursors (Figure 4A). Interestingly, however, P21 expression appears down-regulated during erythropoiesis of ß thalassemic cells in the presence of DIOA.

Since caspase-3 is activated in normal erythropoiesis, playing a pivotal role in both apoptosis and cell maturation towards enucleation,26 we evaluated Casp-3 and Casp-8 gene expression and caspase-3 activity in both cell models of erythropoiesis. In ß thalassemic precursors, expression of both Casp3 and Casp8 genes was up-regulated in late phase erythropoiesis compared to the expression in normal control cells, whereas caspase-3 activity declined to similar low levels in late stage erythropoiesis (day 14) in both control and ß thalassemic precursors (Figure 3). The discrepancy between Casp3 gene expression and caspase-3 protein activity observed in ß thalassemic cells might be related either to the presence of cellular stress factors, inducing Casp-3 gene up-regulation, or to a ubiquitin-dependent proteolytic pathway, as established for p27 protein.29 DIOA did not significantly modify Casp-3 and Casp-8 gene expression in either cell group. In contrast, DIOA treatment was associated with significantly reduced caspase-3 activity in both normal and ß thalassemic cells, but only in the early phase of erythropoiesis (Figure 3B).

In conclusion, this study demonstrates an in vitro correlation of ineffective erythropoiesis in cultured ß thalassemic cells. The data show that ineffective erythropoiesis of in vitro cultured ß thalassemic cells is likely related to impaired cell maturation. The study also strongly suggests that KCC activity may contribute to erythroid cell growth in the late phase erythropoiesis. Further studies are needed to characterize the roles of KCC expression and activity in normal and pathological erythropoiesis.


    Acknowledgments
 
we thank Prof. Luca Baldini and Dr, Lucia Nobili from the University of Milan for their helpful discussion and technical support.


    Footnotes
 
Authors’ contributions

All authors meet the criteria for being contributing authors. LDF, AI, MDC, ASL outlined the study and wrote the paper. LR performed liquid cultures, FACS analyses, and caspase-3 activity assays and organized the data for Figure 1, Table 1 and Figure 3B. CF, SV carried out molecular studies (Figures 2A and 3A), AS and CP performed protein studies and determined cell cation content. All authors were involved in discussion and interpretation of the data; all revised the manuscript and approved the final version.

Conflicts of Interest

The authors reported no potential conflicts of interest.

Funding: this study was supported by FIRB grant RBNE01XHME to MDC, AI and LDF, a Telethon (Prog. GGP02202) grant to AI and NIH grant HL077765 to SLA.

Received for publication March 26, 2007. Accepted for publication July 24, 2007.


    References
 TOP
 ABSTRACT
 Design and Methods
 Results
 Discussion
 References
 

  1. Beuzard Y, Tulliez M, Testa U, Vainchenker W, Dubart A, Tsapis A, et al. ß-thalassemia and sickle cell disease in culture of early erythroid precursors: hemoglobin synthesis and ultrastructural study. Blood Cells 1981;7:179-200.[ISI][Medline]
  2. Srichaikul T, Tipayasakda J, Atichartakarn V, Jootar S, Bovornbinyanun P. Ferrokinetic and erythrokinetic studies in alpha and beta thalassaemia. Clin Lab Haematol 1984;6:133-40.[ISI][Medline]
  3. Olivieri O, De Franceschi L, Capellini MD, Girelli D, Corrocher R, Brugnara C. Oxidative damage and erythrocyte membrane transport abnormalities in thalassemias. Blood 1994;84:315-20.[Abstract/Free Full Text]
  4. Fibach E, Rachmilewitz EA. Flow cytometric analysis of the ploidy of normoblasts in the peripheral blood of patients with bea-thalassemia. Am J Hematol 1993;42:162-5.[CrossRef][ISI][Medline]
  5. Amer J, Goldfarb A, Fibach E. Flow cytometric measurement of reactive oxygen species production by normal and thalassaemic red blood cells. Eur J Haematol 2003;70:84-90.[CrossRef][ISI][Medline]
  6. Mathias LA, Fisher TC, Zeng L, Meiselman HJ, Weinberg KI, Hiti AL, et al. Ineffective erythropoiesis in beta-thalassemia major is due to apoptosis at the polychromatophilic normoblast stage. Exp Hematol 2000;28:1343-53.[CrossRef][ISI][Medline]
  7. Haussinger D, Lang F, Gerok W. Regulation of cell function by the cellular hydration state. Am J Physiol 1994;267:E343-55.[ISI][Medline]
  8. Delpire E, Gullans SR. Cell volume and K+ transport during differentiation of mouse erythroleukemia cells. Am J Physiol 1994;266:C515-23.[ISI][Medline]
  9. Benson RS, Heer S, Dive C, Watson AJ. Characterization of cell volume loss in CEM-C7A cells during dexamethasone-induced apoptosis. Am J Physiol 1996;270:C1190-203.[ISI][Medline]
  10. Shen MR, Chou CY, Hsu KF, Liu HS, Dunham PB, Holtzman EJ, et al. The KCl cotransporter isoform KCC3 can play an important role in cell growth regulation. Proc Natl Acad Sci USA 2001;98:14714-9.[Abstract/Free Full Text]
  11. Shen MR, Chou CY, Hsu KF, Hsu YM, Chiu WT, Tang MJ, et al. KCl cotransport is an important modulator of human cervical cancer growth and invasion. J Biol Chem 2003;278:39941-50.[Abstract/Free Full Text]
  12. Mercado A, Song L, Vazquez N, Mount DB, Gamba G. Functional comparison of the K+-Cl– cotransporters KCC1 and KCC4. J Biol Chem 2000;275:30326-34.[Abstract/Free Full Text]
  13. Howard HC, Mount DB, Rochefort D, Byun N, Dupre N, Lu J, et al. The K-Cl cotransporter KCC3 is mutant in a severe peripheral neuropathy associated with agenesis of the corpus callosum. Nat Genet 2002;32:384-92.[CrossRef][ISI][Medline]
  14. Crable SC, Hammond SM, Papes R, Rettig RK, Zhou GP, Gallagher PG, et al. Multiple isoforms of the KC1 cotransporter are expressed in sickle and normal erythroid cells. Exp Hematol 2005;33:624-31.[CrossRef][ISI][Medline]
  15. Aderson KP, Hammond SM, Gallagher PG, Joiner CH. Expression of a KCC1 splice variant is suppressed by NF-kB in erythroid cells. ASH meeting. San Diego, CA. USA. Blood 2005;476a[abstract].
  16. Lauf PK, Zhang J, Delpire E, Fyffe RE, Mount DB, Adragna NC. K-Cl co-transport: immunocytochemical and functional evidence for more than one KCC isoform in high K and low K sheep erythrocytes. Comp Biochem Physiol A Mol Integr Physiol 2001;130:499-509.[CrossRef][Medline]
  17. Lauf PK, Adragna NC. K-Cl cotransport: properties and molecular mechanism. Cell Physiol Biochem 2000;10:341-54.[CrossRef][ISI][Medline]
  18. Vitoux D, Olivieri O, Garay RP, Cragoe EJ Jr, Galacteros F, Beuzard Y. Inhibition of K+ efflux and dehydration of sickle cells by [(dihydroindenyl)oxy]alkanoic acid: an inhibitor of the K+ Cl– cotransport system. Proc Natl Acad Sci U S A 1989;86:4273-6.[Abstract/Free Full Text]
  19. Olivieri O, Vitoux D, Galacteros F, Bachir D, Blouquit Y, Beuzard Y, et al. Hemoglobin variants and activity of the (K+Cl–) cotransport system in human erythrocytes. Blood 1992;79:793-7.[Abstract/Free Full Text]
  20. Brugnara C, Bunn HF, Tosteson DC. Regulation of erythrocyte cation and water content in sickle cell anemia. Science 1986;232:388-90.[Abstract/Free Full Text]
  21. Franco RS, Palascak M, Thompson H, Joiner CH. KCl cotransport activity in light versus dense transferrin receptor-positive sickle reticulocytes. J Clin Invest 1995;95:2573-80.[ISI][Medline]
  22. Casula S, Shmukler BE, Wilhelm S, Stuart-Tilley AK, Su W, Chernova MN, et al. A dominant negative mutant of the KCC1 K-Cl cotransporter: both N- and C-terminal cytoplasmic domains are required for K-Cl cotransport activity. J Biol Chem 2001;276:41870-8.[Abstract/Free Full Text]
  23. Culliford S, Ellory C, Lang HJ, Englert H, Staines H, Wilkins R. Specificity of classical and putative Cl(–) transport inhibitors on membrane transport pathways in human erythrocytes. Cell Physiol Biochem 2003;13:181-8.[CrossRef][ISI][Medline]
  24. Su W, Shmukler BE, Chernova MN, Stuart-Tilley AK, de Franceschi L, Brugnara C, et al. Mouse K-Cl cotransporter KCC1: cloning, mapping, pathological expression, and functional regulation. Am J Physiol 1999;277:C899-912.[ISI][Medline]
  25. Lee YJ, Panek RB, Huston M, Benveniste EN. Role of protein kinase C and tyrosine kinase activity in IFN-gamma-induced expression of the class II MHC gene. Am J Physiol 1995;268:C127-37.[ISI][Medline]
  26. Carlile GW, Smith DH, Wiedmann M. Caspase-3 has a nonapoptotic function in erythroid maturation. Blood 2004;103:4310-6.[Abstract/Free Full Text]
  27. Krauss SW, Lo AJ, Short SA, Koury MJ, Mohandas N, Chasis JA. Nuclear substructure reorganization during late-stage erythropoiesis is selective and does not involve caspase cleavage of major nuclear substructural proteins. Blood 2005;106:2200-5.[Abstract/Free Full Text]
  28. Bortner CD, Hughes FM Jr, Cidlowski JA. A primary role for K+ and Na+ efflux in the activation of apoptosis. J Biol Chem 1997;272:32436-42.[Abstract/Free Full Text]
  29. Taniguchi T, Endo H, Chikatsu N, Uchimaru K, Asano S, Fujita T, et al. Expression of p21(Cip1/Waf1/Sdi1) and p27(Kip1) cyclin-dependent kinase inhibitors during human hematopoiesis. Blood 1999;93:4167-78.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De Franceschi, L.
Right arrow Articles by Iolascon, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De Franceschi, L.
Right arrow Articles by Iolascon, A.


HOME HELP FEEDBACK TABLE OF CONTENTS ARCHIVE SUBSCRIPTIONS