Haematologica, Vol 92, Issue 2, 232-235 doi:10.3324/haematol.10538
Copyright © 2007 by Ferrata Storti Foundation
Cryptic chromosome 9q34 deletion generates TAF-I
/CAN and TAF-Iß/CAN fusion transcripts in acute myeloid leukemia
Roberto Rosati*,
Roberta La Starza*,
Gianluca Barba,
Paolo Gorello,
Valentina Pierini,
Caterina Matteucci,
Giovanni Roti,
Barbara Crescenzi,
Silvia Romoli,
Teresa Aloisi,
Franco Aversa,
Massimo Fabrizio Martelli,
Cristina Mecucci
From the Hematology and Bone Marrow Transplantation Unit, University of Perugia, 06122 Perugia, Italy
Correspondence: Cristina Mecucci, Hematology and Bone Marrow Transplantation Unit, University of Perugia, Policlinico Monteluce, via Brunamonti 51, 06122 Perugia, Italy. E-mail: crimecux{at}unipg.it
 |
ABSTRACT
|
|---|
In hematologic malignancies chromosome aberrations generating fusion genes include cryptic deletions. In a patient with acute myeloid leukemia and normal karyo-type we discovered a new cryptic 9q34 deletion and here report the cytogenetic and molecular findings. The 9q34 deletion extends 2.5 megabases and juxtaposes the 5' TAF-I to the 3' CAN producing a TAF-I/CAN fusion gene. TAF-I/CAN transcribes into two fusion proteins bearing either TAF-I
or TAF-Iß moieties. We set up molecular assays to monitor the chimeric TAF-I
/CAN and TAF-Iß/CAN transcripts which, after hematopoietic stem cell transplantation from an HLA-identical sibling, were no longer detected.
Key words: AML, 9q34 cryptic deletion, TAF-I/CAN fusion.
Chromosome rearrangements are diagnostic and prognostic markers which serve to classify acute myeloid leukemia (AML) into categories with specific clinical and hematologic features and to orienteer therapeutic choices. In 40–50% of AML with normal karyotype, FLT3 and NPM1 gene mutations are frequent and molecular cytogenetics have occasionally detected cryptic chromosome changes and genomic rearrangements. In a patient with AML-M4 with normal karyotype, and no FLT3 or NPM1 gene mutations we identified a cryptic interstitial del(9)(q34) during interphase fluorescence in situ hybridization (FISH) screening for the BCR/ABL1 fusion. del(9)(q) has been reported as an isolated cytogenetic abnormality or in association with t(8;21)(qq2;q22) in AML;1 cryptic del(9)(q34) has been found at the t(9;22)(q34;q11) translocation breakpoint in chronic myeloid leukemia (CML).2 Here we demonstrate for the first time that a cryptic del(9)(q34) produces a TAF-I/CAN fusion gene.
The CAN gene (also known as NUP214, nuclear pore complex protein 214kDa), mapping at chromosome 9q34, encodes a nucleoporin that participates in nucleocytoplasmic transport through interactions with import/ex port proteins such as hCRM1 and TAP/NFX1.3 TAF-1 (template activating factor-I) is a multi-tasking phosphoprotein involved in chromatin modeling, transcription, cell cycle control and protein phosphatase 2A inhibition.4–7 TAF-I transcribes two isoforms, TAF-I
and TAF-Iß, which bear different N-terminal sequences since they are transcribed from alternative first exons. As they homo-and hetero-dimerize, TAF-I
and TAF-Iß might modulate overall TAF-Iß activity.8 Different levels of TAF-I
and TAF-Iß expression have been observed in various tissues and hematopoietic cell lines suggesting that their expression is tissue and cell-type specific.9 Moreover, functional assays on native and recombinant proteins indicate that TAF-I
mediates chromatin remodeling more weakly than does TAF-Iß.4 As part of the endoplasmic reticulum-associated SET complex, TAF-Iß is cleaved by granzyme A during cytotoxic T-lymphocyte-mediated apoptosis.10
 |
Design and Methods
|
|---|
Case report
A 35-year old man was admitted to our Department because of asthenia, arthralgia, and persistent fever. Clinical examination revealed an enlarged liver. Peripheral blood counts were: hemoglobin 7.9 g/dL, platelets 61x109/L, white blood cells 40x109/L with 90% blasts. Acute myelomonocytic leukemia (AML M4 according to the French-American-British classification) was diagnosed from a bone marrow aspirate. Immunophenotyping was positive for myeloperoxidase, CD34, CD33, CD13, CD45, CD66b, CD15 and CD11b antigens. The karyotype was normal. Sequencing of the FLT3 gene did not show any internal tandem duplications or activating loop mutations. NPM1 exon 12 was normal as assessed by denaturing high-Performance liquid chromatography. 11
The patient received daunorubicin and cytosine arabinoside as induction therapy and achieved remission according to hematologic parameters (<5% blasts on bone marrow smears) and FISH analysis (1.4% of nuclei with one fluorescence signal for ABL1 which is within the cut-off established in our laboratory for ABL1 monosomy/deletion in ten healthy controls). Reverse transcriptase polymerase chain reaction (RT-PCR) detected residual TAF-I/CAN positive clones (data not shown). Four months after diagnosis, the patient underwent hematopoietic stem cell transplantation from his HLA-identical brother.
Fluorescence in situ hybridization
FISH was performed according to previously published protocols.12 The BCR/ABL rearrangement was studied with the LSI BCR/ABL Dual Color, Single Fusion probe (Vysis). A panel of 22 DNA clones was applied to delineate the 9q34 deletion (Figure 1).

View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1. Molecular cytogenetic studies. (A) Array CGH: profile of chromosome 9 shows deletion of clones RP11-98H3 and RP11-17O4. (B) FISH experiments were done with a panel of 22 DNA clones selected for the 9q34 band. (C) Dual color FISH shows hybridization of clones RP11-550J21 (green) and RP11-143H20 (red) to only one chromosome 9. (D) Dual color FISH with clones RP11-216B9 (green) and RP11-544A12 (red) shows signals on both chromosomes 9.
|
|
Array comparative genomic hybridization (CGH)
The patients sample was hybridized to the SpectralChip 2600 BAC Array (Spectral Genomics) following the manufacturers instructions. Fluorescent signals were acquired with a GenePix 4000B scanner (Axon Instruments, Union City, CA, USA) running a GenePix Pro 6.0 software (Axon Instruments). Data were analyzed using SpectralWareTM BAC Array Analysis Software (Spectral Genomics).
Polymerase chain reaction
Bone marrow samples were obtained at diagnosis, after induction therapy, and at 14, 19, and 24 months after the HLA identical transplant. RNA and DNA extraction and cloning were done as already described.13 The TAF-I(SET)/CAN fusion transcripts were amplified using the following primer pairs: SET_540F (GAAGAGGCAGCATGAGGAAC) + CAN_2916R (TACTTTGGGCAAGGATTTGG), 643 bp; SET_540F + CAN_2705R (CGATTGTTGGCTAGGGTGTT) 432 bp; SET_87F (GCAAGAAGCGATTGAACACA) + CAN_2916R, 1096 bp. Isoform-specific PCR were performed with the common reverse primer CAN_2601R (ATCATTCACATCTTGGACAGCA) and either TAFIa_42F (GAAACCAAGACCACCTCCTG) for the TAF-I
isoform, or TAFIb_38F (AGCTCAACTCCAACCACGAC) for TAF-Iß. Del(9)(9) genomic breakpoints were amplified from 100 ng of the patients DNA with primers SET_747F (TGACGAAGAAGGGGATGAGGAT) and CAN_IN17_2R (CTGAGGCATTCAATTAAGTATGTC).
For nested PCR, the first amplification round was performed using primers SET_540F and CAN_2916R. The second round of amplification was performed with primers SET_747F and CAN_2601R. GAPDH (positive control) was amplified with primers GAPD247F (AATCCCATCACCATCTTCCA) and GAPD1147R (AGGGGAGATTCAGTGTGGTG).
 |
Results and Discussion
|
|---|
A DNA probe used to study the BCR/ABL1 rearrangement in our patient with AML M4 did not detect a BCR/ABL1 fusion but gave an atypical hybridization pattern of one red and two green signals in 85% of nuclei, indicating an ABL1 monoallelic loss. The other 15% of nuclei had a normal hybridization pattern. Array CGH confirmed loss of genomic material from chromosome 9q34.1 (clones RP11-98H23 and RP11-17O4, Figure 1A). No other genomic imbalances were identified. Metaphase FISH with a panel of 22 DNA clones for the 9q arm showed the deleted region was flanked by clone RP11-216B9, containing the 5'-end of TAF-I, and clone RP11-544A12, containing the 3'-end of CAN (Figure 1B). The intervening sequence, which included the 3' region of TAF-1 (RP11-550J21) and the 5' region of CAN (RP11-143H20), was lost (Figure 1C–D), suggesting that a 2.5 Mb cryptic deletion at 9q34 juxtaposed TAF-1 and CAN. RT-PCR on a bone marrow sample obtained at diagnosis amplified a TAF-I/CAN fusion transcript joining TAF-I exon 7 with CAN exon 18 (Figure 2A, B). Isoform-specific RT-PCR detected TAF-I
/CAN and TAF-Iß/CAN chimeric transcripts (data not shown). Long-range PCR on the patients genomic DNA identified breakpoints at TAF-1 intron 7 and CAN intron 17 (Figure 3). After induction therapy nested RT-PCR detected residual TAF-I/CAN-expressing clones which were no longer detected after hematopoietic stem cell transplantation from the patients HLA-identical brother (data not shown). At a follow-up of 24 months, the patient is still in hematologic, FISH and molecular remission.

View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 2. Amplification of TAF-I(SET)/CAN fusion cDNA. (A) Agarose gel electrophoresis of TAF-I/CAN fusion transcripts amplified by RT-PCR with the following primer pairs: SC1, SET_540F + CAN_2916R, 643 bp; "SC2", SET_540F + CAN_2705R, 432 bp; "SC3", SET_87F + CAN_2916R, 1096 bp. Lanes "D": amplification from patient cDNA; lanes "B": blanks (no cDNA). "L", marker DNA/HinDIII digest; "123", marker 123bp ladder (Invitrogen). (B) Partial sequence of the "SC2" PCR product showing in-frame fusion between TAF-I(SET) exon 7 (nt. 813 in GenBank accession NM_003011) and CAN exon 18 (nt. 2548 in GenBank accession NM_005085). Sequences corresponding to TAF-I( SET) exon 7 and to CAN exon 18 are underlined.
|
|

View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 3. PCR amplification of the TAF-I(SET)/CAN genomic breakpoint. (A) Agarose gel electrophoresis. Patient DNA (lane "G", 100 ng) was amplified using primers SET_747F and CAN_IN17_2R. Lane "B", blank (no cDNA); lane "L", DNA/HinDIII digest. (B) Partial sequence of the PCR product showing fusion between intron 7 of SET and intron 17 of CAN.
|
|
We demonstrate for the first time that a cryptic 9q34 interstitial deletion, which is easily detected by FISH using a commercially available probe for studying the t(9;22) (q34;q11)-BCR/ABL1, produces a TAF-I/CAN fusion gene. FISH, RT-PCR and genomic PCR were used to monitor our TAF-I/CAN positive AML, which responded partially to chemotherapy and was fully eradicated after hematopoietic stem cell transplantation from an HLA-identical sibling. Finding a cryptic del(9)(q34) as the genomic mechanism underlying a TAF-I/CAN fusion suggests that as long as only cytogenetics and PCR for known fusion proteins are used for genomic studies on AML the incidence of this rearrangement will remain unknown. FISH screening with the LSI BCR/ABL Dual Color, Single Fusion probe in 18 cases of AML with normal karyotype and no NPM1 exon 12 mutations did not detect any other cryptic del(9)(q) (data not shown). Moreover, array-CGH did not detect cryptic del(9)(q34) in AML/myelodysplastic syndrome with isolated trisomy 8 at a karyotypic level, or in CML.14,15
In AML, del(9)(q) are recurrent cytogenetic aberrations which, despite different boundaries, share a 2.4 Mb common deleted sequence at band 9q21.3. Molecular studies of the 11 putative suppressor genes which have been mapped within this region suggest a haploinsufficiency mechanism of one or more critical genes (1). In CML, cryptic del(9)(q34) at the translocation breakpoint of t(9;22) (q34;q11) includes the 5'ABL1 and has a variable extension towards the centromere. Interestingly, the largest deletions seem to have a poor prognostic significance, suggesting that loss of one or more tumor suppressor genes influences disease progression. 2 Cryptic deletions generating fusion genes have occasionally been described in hematologic malignancies. In a subgroup of T-cell acute lymphocytic leukemias the del(1)(p32), a 90 Kb sub-microscopic deletion, places the TAL1 gene under control of the SIL promoter.16 In 30–40% of chronic hypereosinophilic leukemias a del(4)(q12) of roughly 800 Kb generates the FIP1 L1A/PDGFRA fusion protein.17 In two cases of AML, cryptic 11q23 deletions juxtapose LARG or CBL genes with MLL.18,19
Although the chromosomal rearrangements underlying the TAF-I/CAN chimeric fusion are reported here for the first time, involvement of CAN and TAF genes has already been observed in hematologic malignancies. In young adults with AML, CAN was first identified as a partner of DEK in the reciprocal t(6;9)(p23;q34) which accounts for 2–3% of chromosomal rearrangements in AML.20 In one case of acute undifferentiated leukemia with normal karyotype, a variant of the DEK/CAN translocation i.e. the TAF-I/CAN fusion was reported with breakpoints in intron 17 of CAN and 800 bp 3' of the TAF-I gene.21 Although genomic breakpoints were different in our patient, the same TAF-I/CAN fusion was formed as exon 7 of TAF-I was fused to exon 18 of CAN.
One major difference was TAF-I isoform involvement. The TAF-Iß/CAN fusion protein, which was expressed in the case of acute undifferentiated leukemia binds hCRM1, disorganizes nuclear export, causes cell cycle arrest at S phase, partially blocks vitamin D3-induced differentiation and, like DEK/CAN, induces apoptosis in the U937 cell line.22–24 As our patient with AML-M4 expressed both TAF-I
/CAN and TAF-Iß/CAN transcripts, this is the first observation of TAF-I
/CAN. Although the biological impact of TAF-I
/CAN in the leukemogenic process remains to be established, concomitant occurrence of transcripts with both isoforms signifies molecular assays should assess each isoform transcript when monitoring the response to therapy of TAF1/CAN positive AML.
 |
Acknowledgments
|
|---|
DNA clones were kindly provided by Dr. M. Rocchi (DAPEG, University of Bari, Italy). The authors wish to thank Dr. Geraldine Boyd for assistance in preparing the manuscript
 |
Footnotes
|
|---|
* These two authors contributed equally to this work. 
Authors Contributions
RR designed the molecular studies and wrote the paper. RLS designed FISH experiments and wrote the paper. GB and CM performed and interpreted array-CGH studies. PG perfomed molecular studies. VP, selected and validated DNA clones and performed FISH experiments. BC supervised FISH analyses. SR prepared cell cultures and performed cytogenetic analysis. GR perfomed mutational analysis. TA provided clinical data. FA, and MFM were involved in the management of the patient. CM was responsible for the conception and supervision of the study.
Conflicts of Interest
The authors reported no potential conflicts of interest.
Funding: this work was supported by grants from MIUR (Ministero per lIstruzione, lUniversità e la Ricerca Scientifica), FIRC (Fondazione Italiana per la Ricerca sul Cancro, to B. C.) AIRC (Associazione Italiana Ricerca sul Cancro), FIRB (Fondo per gli Investimenti per la Ricerca di Base), Fondazione Cassa di Risparmio di Perugia, AULL (Association for the Study and Therapy of Leukemias and Lymphomas in Umbria), and Associazione "Sergio Luciani", Fabriano, Italy.
Received for publication July 13, 2006.
Accepted for publication November 20, 2006.
 |
References
|
|---|
- Sweetser DA, Peniket AJ, Haaland C, Blomberg AA, Zhang Y, Tanweer Zaidi S, et al. Delineation of the minimal commonly deleted segment and identification of candidate tumor-suppressor genes in del(9q) acute myeloid leukemia. Genes Chromosom Cancer 2005;44:279-91.[CrossRef][Web of Science][Medline]
- Sinclair PB, Nacheva EP, Leversha M, Telford N, Chang A, Reid A, et al. Large deletions at t(9;22) breakpoint are common and may identify a poor-prognosis subgroup of patients with chronic myeloid leukemia. Blood 1999;95:738-44.[Web of Science]
- Fornerod M, van Deursen J, van Baal S, Reynolds A, Davis D, Murti KG, et al. The human homologue of yeast CRM1 is in a dynamic subcomplex with CAN/Nup214 and a novel nuclear pore component Nup88. EMBO J 1997;16:807-16.[CrossRef][Web of Science][Medline]
- Okuwaki M, Nagata K. Template activating factor-I remodels the chromatin structure and stimulates transcription from the chromatin template. J Biol Chem 1998;273:34511-8.[Abstract/Free Full Text]
- Cervoni N, Detich N, Seo SB, Cha kravarti D, Szyf M. The oncoprotein Set/TAF-1ß, an inhibitor of histone acetyltransferase, inhibits active demethylation of DNA, integrating DNA methylation and transcriptional silencing. J Biol Chem 2002;277:25026-31.[Abstract/Free Full Text]
- Canela N, Rodriguez-Vilarrupla A, Estanyol JM, Diaz C, Pujol MJ, Agell N, et al. The SET protein regulates G2/M transition by modulating cyclin B-cyclin-dependent kinase 1 activity. J Biol Chem 2003;278:1158-64.[Abstract/Free Full Text]
- Li M, Makkinje A, Damuni Z. The myeloid leukemia-associated protein SET is a potent inhibitor of protein phosphatase 2A. J Biol Chem 1996;271:11059-62.[Abstract/Free Full Text]
- Miyaji-Yamaguchi M, Okuwaki M, Nagata K. Coiled-coil structure-mediated dimerization of template activating factor-I is critical for its chromatin remodeling activity. J Mol Biol 1999;290:547-57.[CrossRef][Web of Science][Medline]
- Nagata K, Saito S, Okuwaki M, Kawase H, Furuya A, Kusano A, et al. Cellular localization and expression of template-activating factor I in different cell types. Exp Cell Res 1998;240:274-81.[CrossRef][Web of Science][Medline]
- Fan Z, Beresford PJ, Oh DY, Zhang D, Lieberman J. Tumor suppressor NM23-H1 is a granzyme A-activated DNase during CTL-mediated apoptosis, and the nucleosome assembly protein SET is its inhibitor. Cell 2003;112:659-72.[CrossRef][Web of Science][Medline]
- Roti G, Rosati R, Bonasso R, Gorello P, Diverio D, Martelli MF, et al. DHPLC: a valid approach for identifying NPM1 mutations in acute myeloid leukemia. J Mol Diagn 2006;8:254-9.[Abstract/Free Full Text]
- Crescenzi B, La Starza R, Romoli S, Beacci D, Matteucci C, Barba G, et al. Submicroscopic deletions in 5q-associated malignancies. Haematologica 2004;89:281-5.[Abstract/Free Full Text]
- Rosati R, La Starza R, Luciani L, Gorello P, Matteucci C, Pierini V, et al. TPM3/PDGFRB fusion transcript and its reciprocal in chronic eosinophilic leukemia. Leukemia 2006;20:1623-4.[CrossRef][Web of Science][Medline]
- Paulsson K, Heidenblad M, Strömbeck B, Staaf J, Jönsson G, Borg Å, et al. High-resolution menome-wide array-based comparative menome hybridization reveals cryptic chromosome changes in AML and MDS cases with trisomy 8 as the sole cytogenetic aberration. Leukemia 2006;20:840-6.[CrossRef][Web of Science][Medline]
- Hosoya N, Sanada M, Nannya Y, Nakazaki K, Wang L, Hangaishi A, et al. Genomewide screening of DNA copy number changes in chronic myelogenous leukemia with the use of high-resolution array-based comparative genomic hybridization. Genes Chromosom Cancer 2006;45:482-94.[CrossRef][Web of Science][Medline]
- Breit TM, Mol EJ, Wolvers-Tettero IL, Ludwig WD, van Wering ER, van Dongen JJ. Site-specific deletions involving the tal-1 and sil genes are restricted to cells of the T cell receptor
/ßlineage: T cell receptor
gene deletion mechanism affects multiple genes. J Exp Med 1993;177:965-77.[Abstract/Free Full Text] - Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD, Cortes J, et al. A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of imatinib in idiopathic hypereosinophilic syndrome. N Engl J Med 2003;348:1201-14.[Abstract/Free Full Text]
- Fu JF, Hsu JJ, Tang TC, Shih LY. Identification of CBL, a proto-oncogene at 11q23.3, as a novel MLL fusion partner in a patient with de novo acute myeloid leukemia. Genes Chromo somes Cancer 2003;37:214-9.[CrossRef]
- Kourlas PJ, Strout MP, Becknell B, Veronese ML, Croce CM, Theil KS, et al. Identification of a gene at 11q23 encoding a guanine nucleotide exchange factor: evidence for its fusion with MLL in acute myeloid leukemia. Proc Natl Acad Sci USA 2000;97:2145-50.[Abstract/Free Full Text]
- Soekarman D, von Lindern M, Daenen S, de Jong B, Fonatsch C, Heinze B, et al. The translocation (6;9) (p23;q34) shows consistent rearrangement of two genes and defines a myeloproliferative disorder with specific clinical features. Blood 1992;79:2990-7.[Abstract/Free Full Text]
- von Lindern M, van Baal S, Wiegant J, Raap A, Hagemeijer A, Grosveld G. CAN, a putative oncogene associated with myeloid leukemogenesis, may be activated by fusion of its 3' half to different genes: characterization of the set gene. Mol Cell Biol 1992;12:3346-55.[Abstract/Free Full Text]
- Fornerod M, Boer J, van Baal S, Morreau H, Grosveld G. Interaction of cellular proteins with the leukemia specific fusion proteins DEK-CAN and SET-CAN and their normal counterpart, the nucleoporin CAN. Oncogene 1996;13:1801-8.[Web of Science][Medline]
- Boer J, Bonten-Surtel J, Grosveld G. Over expression of the nucleoporin CAN/NUP214 induces growth arrest, nucleocytoplasmic transport defects, and apoptosis. Mol Cell Biol 1998;18:1236-47.[Abstract/Free Full Text]
- Kandilci A, Mientjes E, Grosveld G. Effects of SET and SET-CAN on the differentiation of the human promonocytic cell line U937. Leukemia 2004;18:337-40.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
P. Van Vlierberghe, M. van Grotel, J. Tchinda, C. Lee, H. B. Beverloo, P. J. van der Spek, A. Stubbs, J. Cools, K. Nagata, M. Fornerod, et al.
The recurrent SET-NUP214 fusion as a new HOXA activation mechanism in pediatric T-cell acute lymphoblastic leukemia
Blood,
May 1, 2008;
111(9):
4668 - 4680.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Ozbek, A. Kandilci, S. van Baal, J. Bonten, K. Boyd, P. Franken, R. Fodde, and G. C. Grosveld
SET-CAN, the Product of the t(9;9) in Acute Undifferentiated Leukemia, Causes Expansion of Early Hematopoietic Progenitors and Hyperproliferation of Stomach Mucosa in Transgenic Mice
Am. J. Pathol.,
August 1, 2007;
171(2):
654 - 666.
[Abstract]
[Full Text]
[PDF]
|
 |
|