Hemostasis |
From the Departamento de Farmacologia, State University of Campinas (NCS, MLB-C); Hemocentro Unicamp, State University of Campinas, UNICAMP, Campinas, Brazil (JMA-B, MFL, VC)
Correspondence: Maria Lourdes Barjas-Castro, Hemocentro, UNICAMP/State University of Campinas–Unicamp, Rua Carlos Chagas, 480, PO Box–6198/CEP: 13083-970, Campinas–SP, Brazil. E-mail: maluz{at}unicamp.br
|
|
|---|
Key words: ABO, blood groups, factor VIII, von Willbrand factor.
Von Willebrand factor (VWF) is a multimeric glycoprotein whose circulating plasma levels vary significantly within and between individuals. These variations have been associated with ABO blood type, estrogen levels, age and stress.1–4 In particular, ABO blood type exerts a major effect on plasma VWF levels. Recent studies have demonstrated that individuals carrying one O allele (AO and BO) have significantly lower plasma levels of VWF and FVIII than those carrying no O allele (AA, AB and BB).5 The antigens of the ABO system consist of complex carbohydrate molecules. The A and B alleles encode A and B glycosyltransferase, which convert H antigen into A or B determinants. Group O individuals lack transferase enzymes and, consequently, continue to express H antigen.6 In addition to the common phenotypes A1 and A2, numerous phenotypes with weak expression of A or B antigens have been found. Most of these phenotypes can be fitted into the following categories: A3, Ax, Ael, B3 and Bel. All have enhanced expression of H antigen.7 ODonnel et al.,8 described a direct relationship between ABO genotype, A transferase expression, and the amount of A antigen expressed on circulating VWF. The susceptibility of VWF of blood group O, A, B and AB to proteolysis by the ADAMTS 13 metalloprotease was investigated and multimeric analysis indicated that the rate of VWF proteolysis differed between blood groups and was greater for group O VWF than for non-O VWF.9 The aim of this study was to correlate ABO groups and rare subgroups with plasma levels of factor VIII (FVIII), von Willebrand factor (VWF:Ag), and ristocetin cofactor (VWF:RCo).
|
|
|---|
ABO phenotypes were determined by agglutination and adsorption-elution tests using monoclonal and polyclonal anti-A, B and AB antibodies (Asem-NPBI, Itapecirica da Serra, São Paulo Brazil; DiaMed SA, Cressier s/Morat, Suisse; DiaMed Latino América, Lagoa Santa, Brazil). H antigen was determined using anti–H lectin from Ulex europaeus (DiaMed Latino América, Lagoa Santa, Brazil) and the agglutination reaction intensity was evaluated according to Marsh et al.11 Serum screening for isoagglutinins and antibodies was performed by tube agglutination tests at 4°C and 22°C and by standardized serological procedures with a microtyping system (DiaMed SA, Cressier s/Morat, Suisse).10 Saliva testing was performed using a technique described elsewhere.10 Subgroup serologic status was defined according to Daniels.7
Genomic DNA was extracted from blood conserved with EDTA using the standard phenol-chloroform technique. ABO genotyping was performed by polymerase chain reaction (PCR) amplification of exons 6 and 7 of the ABO gene, followed by diagnostic restriction enzyme digestion. Four different primers were used to amplify two fragments, each spanning a different polymorphic site of the ABO gene. Primers, exon 6: P1–5'-TGCCAGCTCCATGTGACCGC 3' (sense), P2–5' TCGCCACTGCCTGGGTCTCTAC 3' (antisense); exon 7: P3–5' CCGTCCGCCTGCCTTGCAG 3' (sense), P4–5' TGCCGGCAGCCCTCCCAGAG 3' (antisense). Primers P1/P2 in conjunction with the restriction enzyme KpnI and BstE I were used to differentiate the O1 allele from the A, B and O2 alleles.12 Primers P3/P4 in conjunction with the restriction enzyme AluI were used to differentiate the A2 from the A1 allele. These same primers with the restriction enzyme MboI were used to discriminate the AX from A1, A2 and A3 alleles.13 A3(3) and Bel(1) serological and genetic molecular studies were previously described.14,15 The ABO alleles are named according to the nomenclature used in the Blood Group Antigen Gene Mutation Database (http://www.bioc.aecom.yu.edu/bgmut/abo.htm).
Factor VIII coagulant was measured by a one stage clothing method using a factor-VIII deficient substrate.16 The activity of vWF was measured by ristocetin cofactor assay – VWF:RCo – (Helena Laboratories, Beaumont, Texas, USA). VWF:Ag was measured by an enzyme-linked immunosorbent assay (ELISA) using polyclonal antiserum (Dako, Denmark). Lyophilised commercial reference preparations of VWF:Ag, FVIII and VWF:RCo, standardized against the World Health Organization standard, were used as the standards in this study.
Statistical analysis
Statistical analysis was performed using Wilcoxons rank sum test and Spearmans rank correlation. p values
0.05 were considered statistically significant.
|
|
|---|
![]() View larger version (17K): [in a new window] [Download PPT slide] |
Figure 1 (A,B,C). Box-and-whisker plots representing the circulating levels of von Willebrand factor (VWF:Ag), factor VIII (FVIII) and ristocetin cofactor activity (VWF:RCo) in individuals with different blood groups. The graphics present the groups with statistically different results. The plots show a box defined by the lower and upper quartiles with the median factor dosages represented by a subdivision of the box. A. VWF:Ag median (%). B. FVIII (%). C. VWF:RCo.
|
This study was carried out to assess FVIII, VWF:Ag and VWF:RCo in 114 healthy male blood donors. It was restricted to males to avoid possible estrogen-related effects, although gender differences in FVIII and VWF:Ag were not seen in two previous studies of younger populations. 3,17 Our data demonstrated a strong correlation between VWF:Ag plasma levels and FVIII and also between VWF:Ag and VWF:RCo. The donors were ABO genotyped and the results clearly showed a significant linkage between the ABO locus and VWF antigen (p=0.001). Subjects with H-antigen-rich blood groups had significantly lower levels of FVIII and VWF:Ag antigen than did individuals with H-antigen-poor groups.18 A2O1 subjects had lower levels of VWF, FVIII, and VWF:RCo than did AA, AB, BB and A2B subjects and higher levels than O1O1 subjects. These data corroborate a case-control study in which group O and A2 individuals, presenting low levels of FVIII, were considered to have a low risk of thrombosis, in contrast to group A1, A1B and B1 individuals. 19 The observation of high VWF:Ag levels in A2B individuals was unexpected. The antigen H investigation showed score 0 for A2B, the same value for AA, AB, BB and also for heterozygous AO and BO groups. The biological and clinical implications of this observation are unclear.
One interesting finding was that A3O1, AxO1 and BelO1 subgroups had significantly lower VWF:Ag and FVIII levels when compared to the A2B group, but no difference when compared to O1O1 and A2O1. These subgroups are, however, rare and thus the study numbers were small (eight cases). Previous reports have demonstrated that the normal range of VWF:Ag found in group O individuals reaches below 50 IU/dL.8 Unless ABO group-specific VWF:Ag references ranges are used, normal group O and also ABO subgroup individuals could be identifying as having a level of VWF below the normal reference range and therefore at potential risk of bleeding. These results favor the hypothesis that the expression of H antigen on VWF is one of the most important determinants of circulating levels of VWF:Ag.8 In conclusion, we demonstrated that the circulating levels of VWF:Ag and FVIII in subjects with rare subgroups were similar to those found in group O individuals. These data could contribute to the diagnosis of von Willebrands disease and to the evaluation of thrombophilia in individuals with different ABO subgroups.
NCS: acquisition of data, analysis and interpretation of data; drafting the article; final approval of submitted version; JM A–B: hemostasis laboratory head; conception; analysis and interpretion of data; critical review and final approval; MFL: immunohematology laboratory biologist (head); acquisition of data, analysis and interpretation of data; final approval of submitted version; VC: analysis and interpretion of data; critical review; final approval of submitted version; MLB-C: senior author (tutor) and grant recipient; study conception and design; analysis and interpretion of data; critical review and final approval of submitted version.
The authors reported no potential conflicts of interest.
Funding: Grant sponsor FAPESP, Fundação de Amparo a Pesquisa do Estado de São Paulo. Grant number 03/01904-9.
Received for publication June 26, 2006. Accepted for publication October 16, 2006.
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||