Haematologica
HOME HELP FEEDBACK TABLE OF CONTENTS ARCHIVE SUBSCRIPTIONS
 QUICK SEARCH:   [advanced]


     


Haematologica, Vol 92, Issue 2, 236-239 doi:10.3324/haematol.10457
Copyright © 2007 by Ferrata Storti Foundation
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sousa, N. C.
Right arrow Articles by Barjas-Castro, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sousa, N. C.
Right arrow Articles by Barjas-Castro, M. L.

Hemostasis

The relationship between ABO groups and subgroups, factor VIII and von Willebrand factor

Norma Cristina Sousa, Joyce Maria Anicchino-Bizzacchi, Maria Fátima Locatelli, Vagner Castro, Maria Lourdes Barjas-Castro

From the Departamento de Farmacologia, State University of Campinas (NCS, MLB-C); Hemocentro Unicamp, State University of Campinas, UNICAMP, Campinas, Brazil (JMA-B, MFL, VC)

Correspondence: Maria Lourdes Barjas-Castro, Hemocentro, UNICAMP/State University of Campinas–Unicamp, Rua Carlos Chagas, 480, PO Box–6198/CEP: 13083-970, Campinas–SP, Brazil. E-mail: maluz{at}unicamp.br


    ABSTRACT
 TOP
 ABSTRACT
 Design and Methods
 Results and Discussion
 References
 
The aim of this study was to correlate ABO groups with plasma levels of factor VIII (FVIII), von Willebrand factor (VWF:Ag), and ristocetin cofactor (VWF:RCo). Serological and molecular tests defined blood groups from 114 donors (10 AA, 10 BB, 10 AB, 10 AO1, 10 BO1,16 O1O1, 20 A2O1, 20 A2B, 4 A3O1, 3 AxO1, and 1 BelO1). The levels of VWF:Ag, FVIII and VWF:RCo observed in rare subgroups (A3O1, AxO1, BelO1) were similar to the values found in the O1O1 group. However, levels of these factors were significantly higher in A2O1 donors than in O1O1 donors (VWF:Ag p=0.01; FVIII p=0.04; VWF:RCo p<0.001). Strong correlations were demonstrated between plasma levels of VWF:Ag and FVIII (R=0.77; p=0.001) and between VWF:Ag and VWF:RCo (R=0.75; p=0.001).

Key words: ABO, blood groups, factor VIII, von Willbrand factor.

Von Willebrand factor (VWF) is a multimeric glycoprotein whose circulating plasma levels vary significantly within and between individuals. These variations have been associated with ABO blood type, estrogen levels, age and stress.14 In particular, ABO blood type exerts a major effect on plasma VWF levels. Recent studies have demonstrated that individuals carrying one O allele (AO and BO) have significantly lower plasma levels of VWF and FVIII than those carrying no O allele (AA, AB and BB).5 The antigens of the ABO system consist of complex carbohydrate molecules. The A and B alleles encode A and B glycosyltransferase, which convert H antigen into A or B determinants. Group O individuals lack transferase enzymes and, consequently, continue to express H antigen.6 In addition to the common phenotypes A1 and A2, numerous phenotypes with weak expression of A or B antigens have been found. Most of these phenotypes can be fitted into the following categories: A3, Ax, Ael, B3 and Bel. All have enhanced expression of H antigen.7 O’Donnel et al.,8 described a direct relationship between ABO genotype, A transferase expression, and the amount of A antigen expressed on circulating VWF. The susceptibility of VWF of blood group O, A, B and AB to proteolysis by the ADAMTS 13 metalloprotease was investigated and multimeric analysis indicated that the rate of VWF proteolysis differed between blood groups and was greater for group O VWF than for non-O VWF.9 The aim of this study was to correlate ABO groups and rare subgroups with plasma levels of factor VIII (FVIII), von Willebrand factor (VWF:Ag), and ristocetin cofactor (VWF:RCo).


    Design and Methods
 TOP
 ABSTRACT
 Design and Methods
 Results and Discussion
 References
 
Samples from 114 blood donors with known blood groups and subgroups were submitted to ABO serology and molecular analysis, VWF:Ag and FVIII dosages and ristocetin cofactor assay. The donors were males with no history of taking drugs. The age of the donors ranged from 18–60 years old (median age 32). The donors were instructed regarding the nature and non-compulsory character of the research, and signed informed consent was obtained prior to collecting samples. This study was approved by the Research Ethics Committee of the State University of Campinas and Brazilian Medical Research Committee. Blood was drawn by venipuncture into evacuated siliconized glass tubes containing 3.2% sodium citrate, in a ratio of 1:9 with blood, for ristocetin cofactor assay, VWF:Ag and factor VIII dosages. Blood processing was completed within 2 hours. Blood samples for ABO serology and molecular analysis were collected according to standard blood banking practice.10

ABO phenotypes were determined by agglutination and adsorption-elution tests using monoclonal and polyclonal anti-A, B and AB antibodies (Asem-NPBI, Itapecirica da Serra, São Paulo Brazil; DiaMed SA, Cressier s/Morat, Suisse; DiaMed Latino América, Lagoa Santa, Brazil). H antigen was determined using anti–H lectin from Ulex europaeus (DiaMed Latino América, Lagoa Santa, Brazil) and the agglutination reaction intensity was evaluated according to Marsh et al.11 Serum screening for isoagglutinins and antibodies was performed by tube agglutination tests at 4°C and 22°C and by standardized serological procedures with a microtyping system (DiaMed SA, Cressier s/Morat, Suisse).10 Saliva testing was performed using a technique described elsewhere.10 Subgroup serologic status was defined according to Daniels.7

Genomic DNA was extracted from blood conserved with EDTA using the standard phenol-chloroform technique. ABO genotyping was performed by polymerase chain reaction (PCR) amplification of exons 6 and 7 of the ABO gene, followed by diagnostic restriction enzyme digestion. Four different primers were used to amplify two fragments, each spanning a different polymorphic site of the ABO gene. Primers, exon 6: P1–5'-TGCCAGCTCCATGTGACCGC 3' (sense), P2–5' TCGCCACTGCCTGGGTCTCTAC 3' (antisense); exon 7: P3–5' CCGTCCGCCTGCCTTGCAG 3' (sense), P4–5' TGCCGGCAGCCCTCCCAGAG 3' (antisense). Primers P1/P2 in conjunction with the restriction enzyme KpnI and BstE I were used to differentiate the O1 allele from the A, B and O2 alleles.12 Primers P3/P4 in conjunction with the restriction enzyme AluI were used to differentiate the A2 from the A1 allele. These same primers with the restriction enzyme MboI were used to discriminate the AX from A1, A2 and A3 alleles.13 A3(3) and Bel(1) serological and genetic molecular studies were previously described.14,15 The ABO alleles are named according to the nomenclature used in the Blood Group Antigen Gene Mutation Database (http://www.bioc.aecom.yu.edu/bgmut/abo.htm).

Factor VIII coagulant was measured by a one stage clothing method using a factor-VIII deficient substrate.16 The activity of vWF was measured by ristocetin cofactor assay – VWF:RCo – (Helena Laboratories, Beaumont, Texas, USA). VWF:Ag was measured by an enzyme-linked immunosorbent assay (ELISA) using polyclonal antiserum (Dako, Denmark). Lyophilised commercial reference preparations of VWF:Ag, FVIII and VWF:RCo, standardized against the World Health Organization standard, were used as the standards in this study.

Statistical analysis
Statistical analysis was performed using Wilcoxon’s rank sum test and Spearman’s rank correlation. p values ≤0.05 were considered statistically significant.


    Results and Discussion
 TOP
 ABSTRACT
 Design and Methods
 Results and Discussion
 References
 
The ABO serological and genotype distribution were AA (n=10), BB (n=10), AB (n=10), AO1 (n=10), BO1 (n=10), O1O1 (n=16), A2O1 (n=20), A2B (n=20), A3O1 (n=4), AxO1 (n=3), and BelO1 (n=1). The antigen H investigation showed a score of 11 or 12 for O1O1, a score of 0 for AA, BB, AB, A2B, AO1 and BO1; a score of 7 or 8 for A2O1; and a score of 10 or 11 for A3O, AxO and BelO.11 The rare subgroups A3O, AxO and BelO, were considered as single group for the statistical analysis. Group O individuals and those carrying this allele had significantly lower levels of VWF:Ag, FVIII and VWF:RCo than did individuals of groups AA, AB and BB. The median levels of these factors were lower in subgroup A2O1 (VWF:Ag=89%; FVIII=96%; VWF:RCo=99%) than in subgroups AA, AB and BB (median: VWF: Ag=120%, p<0.001; FVIII=117%, p<0.001, VWF: RCo=19%, p<0.001) and A2B (median: VWF:Ag=169%, p<0.001; FVIII=112%, p<0.001; VWF:RCo=132%, p=0.001) and higher than in subgroup O1O1 (median: VWF:Ag=69%, p=0.018; FVIII=75%, p=0.048; VWF: RCo=65%, p<0.001). The levels of the same factors in A3O1, AXO1 and BelO1 donors (median: VWF:Ag=75%; FVIII:C=88%; VWF:RCo=76%) were statistically significantly lower than those in groups AA, AB and BB (VWF:Ag, p<0.001; FVIII, p=0.004; VWF:RCo, p<0.001) and A2B (VWF:Ag, p<0.001; FVIII, p=0.001; VWF:RCo, p<0.001) (Figure 1). However, no statistically significant differences were observed when the results obtained in rare subgroups were compared with those in O1O1 (VWF:Ag, p=0.49; FVIII p=0.57; VWF:RCo, p=0.23), AO1/BO1 (median: VWF:Ag=80%, p=0.89; FVIII=89%, p=0.95; VWF:RCo=86%, p=0.95) and A2O1 for VWF and FVIII (VWF:Ag, p=0.66; FVIII, p=0.57). VWF:RCo in A3O1, AXO1 and BelO1 subgroups was statistically different from that in subgroup A2O1 (p=0.029). The results also showed higher VWF levels in A2B individuals (median: VWF:Ag=169%) than in the AA, AB and BB groups (p=0.013) (Figure 1A).


Figure 10920236
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1 (A,B,C). Box-and-whisker plots representing the circulating levels of von Willebrand factor (VWF:Ag), factor VIII (FVIII) and ristocetin cofactor activity (VWF:RCo) in individuals with different blood groups. The graphics present the groups with statistically different results. The plots show a box defined by the lower and upper quartiles with the median factor dosages represented by a subdivision of the box. A. VWF:Ag median (%). B. FVIII (%). C. VWF:RCo.

 
Overall, there was a strong correlation between VWF:Ag and FVIII levels (R=0.77; p=0.001) and between VWF:Ag and VWF:RCo levels (R=0.75; p=0.001) (Spearman’s rank correlation).

This study was carried out to assess FVIII, VWF:Ag and VWF:RCo in 114 healthy male blood donors. It was restricted to males to avoid possible estrogen-related effects, although gender differences in FVIII and VWF:Ag were not seen in two previous studies of younger populations. 3,17 Our data demonstrated a strong correlation between VWF:Ag plasma levels and FVIII and also between VWF:Ag and VWF:RCo. The donors were ABO genotyped and the results clearly showed a significant linkage between the ABO locus and VWF antigen (p=0.001). Subjects with H-antigen-rich blood groups had significantly lower levels of FVIII and VWF:Ag antigen than did individuals with H-antigen-poor groups.18 A2O1 subjects had lower levels of VWF, FVIII, and VWF:RCo than did AA, AB, BB and A2B subjects and higher levels than O1O1 subjects. These data corroborate a case-control study in which group O and A2 individuals, presenting low levels of FVIII, were considered to have a low risk of thrombosis, in contrast to group A1, A1B and B1 individuals. 19 The observation of high VWF:Ag levels in A2B individuals was unexpected. The antigen H investigation showed score 0 for A2B, the same value for AA, AB, BB and also for heterozygous AO and BO groups. The biological and clinical implications of this observation are unclear.

One interesting finding was that A3O1, AxO1 and BelO1 subgroups had significantly lower VWF:Ag and FVIII levels when compared to the A2B group, but no difference when compared to O1O1 and A2O1. These subgroups are, however, rare and thus the study numbers were small (eight cases). Previous reports have demonstrated that the normal range of VWF:Ag found in group O individuals reaches below 50 IU/dL.8 Unless ABO group-specific VWF:Ag references ranges are used, normal group O and also ABO subgroup individuals could be identifying as having a level of VWF below the normal reference range and therefore at potential risk of bleeding. These results favor the hypothesis that the expression of H antigen on VWF is one of the most important determinants of circulating levels of VWF:Ag.8 In conclusion, we demonstrated that the circulating levels of VWF:Ag and FVIII in subjects with rare subgroups were similar to those found in group O individuals. These data could contribute to the diagnosis of von Willebrand’s disease and to the evaluation of thrombophilia in individuals with different ABO subgroups.


    Footnotes
 
Authors’ Contributions

NCS: acquisition of data, analysis and interpretation of data; drafting the article; final approval of submitted version; JM A–B: hemostasis laboratory head; conception; analysis and interpretion of data; critical review and final approval; MFL: immunohematology laboratory biologist (head); acquisition of data, analysis and interpretation of data; final approval of submitted version; VC: analysis and interpretion of data; critical review; final approval of submitted version; MLB-C: senior author (tutor) and grant recipient; study conception and design; analysis and interpretion of data; critical review and final approval of submitted version.

Conflicts of Interest

The authors reported no potential conflicts of interest.

Funding: Grant sponsor FAPESP, Fundação de Amparo a Pesquisa do Estado de São Paulo. Grant number 03/01904-9.

Received for publication June 26, 2006. Accepted for publication October 16, 2006.


    References
 TOP
 ABSTRACT
 Design and Methods
 Results and Discussion
 References
 

  1. Preston AE, Barr A. The Plasma Concentration of Factor Viii in the Normal Population. Ii. The Effects of Age, Sex and Blood Group. Br J Haematol 1964;10:238-45.[Web of Science][Medline]
  2. Mohanty D, Ghosh K, Marwaha N, Kaur S, Chauhan AP, Das KC. Major blood group antigens: a determinant of factor VIII levels in blood? Thromb Haemost 1984;51:414.[Web of Science][Medline]
  3. Orstavik KH, Magnus P, Reisner H, Berg K, Graham JB, Nance W. Factor VIII and factor IX in a twin population. Evidence for a major effect of ABO locus on factor VIII level. Am J Hum Genet 1985;37:89-101.[Web of Science][Medline]
  4. Gill JC, Endres-Brooks J, Bauer PJ, Marks WJ Jr, Montgomery RR. The effect of ABO blood group on the diagnosis of von Willebrand disease. Blood 1987;69:1691-5.[Abstract/Free Full Text]
  5. Shima M, Fujimura Y, Nishiyama T, Tsujiuchi T, Narita N, Matsui T, et al. ABO blood group genotype and plasma von Willebrand factor in normal individuals. Vox Sang 1995;68:236-40.[Web of Science][Medline]
  6. Watkins WM. Biochemistry and Genetics of the ABO, Lewis, and P blood group systems. Adv Hum Genet 1980;10:1-136.[Medline]
  7. Daniels G. Human Blood Groups. 2. Oxford: Blackwell Science Ltd. 2002.
  8. O’Donnell J, Boulton FE, Manning RA, Laffan MA. Amount of H antigen expressed on circulating von Willebrand factor is modified by ABO blood group genotype and is a major determinant of plasma von Willebrand factor antigen levels. Arterioscler Thromb Vasc Biol 2002;22:335-41.[Abstract/Free Full Text]
  9. Bowen DJ. An influence of ABO blood group on the rate of proteolysis of von Willebrand factor by ADAMTS13. J Thromb Haemost 2003;1:33-40.[CrossRef][Web of Science][Medline]
  10. Technical Manual: American Association of Blood Banks. 15. Bethesda, Maryland: AABB Press. 2005.
  11. Marsh WL. Scoring of hemagglutination reactions. Transfusion 1972;12:352-3.[Web of Science][Medline]
  12. Olsson ML, Chester MA. A rapid and simple ABO genotype screening method using a novel B/O2 versus A/O2 discriminating nucleotide substitution at the ABO locus. Vox Sang 1995;69:242-7.[Web of Science][Medline]
  13. Olsson ML, Irshaid NM, Hosseini-Maaf B, Hellberg A, Moulds MK, Sareneva H, et al. Genomic analysis of clinical samples with serologic ABO blood grouping discrepancies: identification of 15 novel A and B subgroup alleles. Blood 2001;98:1585-93.[Abstract/Free Full Text]
  14. Barjas-Castro ML, Carvalho MH, Locatelli MF, Bordin S, Saad ST. Molecular heterogeneity of the A3 subgroup. Clin Lab Haematol 2000;22:73-8.[CrossRef][Web of Science][Medline]
  15. Sousa N, Anicchino-Bizzacchi JM, Leite EM, Locatelli MF, Albuquerque D, Costa FF, et al. Association of ABO gene mutations resulting in a rare B subgroup. Vox Sang 2005;88:31-4.[CrossRef][Web of Science][Medline]
  16. Zacharski LR, Rosenstein R. Standardization of the one-stage assay for factor VIII (antihemophilic factor). Am J Clin Pathol 1978;70:280-6.[Web of Science][Medline]
  17. Green D, Ruth KJ, Folsom AR, Liu K. Hemostatic factors in the Coronary Artery Risk Development in Young Adults (CARDIA) Study. Arterioscler Thromb 1994;14:686-93.[Abstract/Free Full Text]
  18. Schleef M, Strobel E, Dick A, Frank J, Schramm W, Spannagl M. Relationship between ABO and Secretor genotype with plasma levels of factor VIII and von Willebrand factor in thrombosis patients and control individuals. Br J Haematol 2005;128:100-7.[CrossRef][Web of Science][Medline]
  19. Tirado I, Mateo J, Soria JM, Oliver A, Martinez-Sanchez E, Vallve C, et al. The ABO blood group genotype and factor VIII levels as independent risk factors for venous thromboembolism. Thromb Haemost 2005;93:468-74.[Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sousa, N. C.
Right arrow Articles by Barjas-Castro, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sousa, N. C.
Right arrow Articles by Barjas-Castro, M. L.


HOME HELP FEEDBACK TABLE OF CONTENTS ARCHIVE SUBSCRIPTIONS