Published online 12 August 2008
Haematologica, Vol 93, Issue 10, 1590-1591 doi:10.3324/haematol.13295
Copyright © 2008 by Ferrata Storti Foundation
Disorders of Bilirubin Metabolism |
Large deletion in UGT1A1 gene encompassing the promoter and the exon 1 responsible for Crigler-Najjar type I syndrome
François M. Petit1,
Marylise Hébert1,
Vincent Gajdos2,
Liliane Capel1,
Ridha MRad3,
Philippe Labrune2
1 Department of Biochemistry, Hormonology and Genetic
2 Department of Paediatrics and Clinical Genetics, Antoine Béclère Hospital, Universitè Paris Sud
3 Service de Maladies Congénitales, Hopital Charles Nicolle, Tunis, Tunisie Key words: Crigler-Najjar syndrome type I, uridine diphosphate glucuronosyltransferase 1A1 - UGT1A1), polymerase chain reaction
Correspondence: François M. Petit, Department of Biochemistry, Hormonology and Genetics, Antoine Béclère Hospital, 157 rue de la Porte de Trivaux, 92141, Clamart Cedex, France. Phone: international +33.1.45374309., E-mail:francois.petit{at}abc.aphp.fr
Crigler-Najjar type I syndrome (CN-I, MIM #218800) is due to a complete and non-inductile deficiency of bilirubin-UDP-glucuronosyltransferase activity (EC 2.4.1.17, gene UGT1A1 located on 2q37.1).1 Currently, over 90 genetic alterations such as mutations, small insertions or small deletions have been described in the five exons of the UGT1A1 gene responsible for bilirubin conjugation activity deficiency. Large deletions (>20 bp) are rare genetic alterations in human genetics comprising only 5.8% of all genetic lesions referenced (Human Gene Mutation Database; http://www.hgmd.cf.ad.uk). Such genomic rearrangements could be due either to homologous or non-homologous recombination.2,3 The only large deletion described in the UGT1A1 gene has been reported by Seppen et al. in 1994.4 The patient was homozygous for a deletion of the exon 2 responsible for CN-I but exact breakpoints have not been characterized.
We report the case of a male CN-I child in whom molecular studies allowed us to identify a large deletion encompassing the promoter and the exon 1 of UGT1A1 gene. The infant was born at full term after an uneventful pregnancy. During the neonatal period, he presented an elevation of the serum bilirubin to 250–300 µmol/L, entirely unconjugated, with peaks at 600 µmol/L, contrasting with an absence of neurological manifestations. Intensive phototherapy and enzymatic induction by phenobarbital were inefficient in reducing the serum bilirubin concentration. At two weeks, the diagnosis of Crigler-Najjar was suspected and blood was sampled for molecular studies. Blood from parents, who are first cousins, were also sampled. Genomic DNA was extracted from peripheral leucocytes of the child and his parents. The promoter and the five exons with the flanking intron-exon junctions were PCR-amplified as previously described.5,6 On two different blood samples, no amplification of the promoter and the exon 1 for the child was available. On the other hand, the parents promoter and exon 1 were correctly amplified and no genetic sequence alteration was observed after sequencing. Since they are consanguineous, an identical large deletion, including at least the promoter and the exon 1, was suspected at the heterozygote state in the parents explaining their normal electrophoretic profile. This deletion – transmitted to the child at the homozygote state – would be responsible for the phenotype and could explain the absence of amplification of the promoter and the exon 1. To verify the large deletion hypothesis, several couples of primers were designed to amplify 8 small genomic regions around the promoter and the exon 1 (Table 1). These markers were called D01 to D04 from the promoter towards the centromere and D11 to D14 from the exon 1 towards the telomere. Firstly, the deletion was localized between 2680 bp (amplification of D03) upstream and 2794 bp (amplification of D12) downstream from the codon start adenine in exon 1 (Figure 1). Primers surrounding this region were used to determine the exact breakpoints by amplification and sequencing (5 agcaaggacagatatgcaaa 3 on forward and 5 acacctaagcctgactgcac 3 on reverse). A 4591 bp-deletion was characterized in the child and his parents covering 2335 bp in 5UTR, the exon 1 and 1377 bp in the intron 1–2. Moreover, the sequences of the child and his parents were strongly reorganized in 5 with several sequence alterations such as mutations (10), insertion-deletions (2), duplication (1) and an insertion (23 bp between the breakpoints).

View larger version (6K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1. Localization of the genetic markers and the deletion breakpoints in the UGT1A1 genetic region. Physical distances have been calculated in relation to adenine in the codon start. With child genomic DNA, no amplification was available for D02, D01, promoter, exon 1 and D11. The deletion encompasses 4591 bp.
|
|
Large deletions are rarely involved in Crigler-Najjar disease but their frequency is probably underestimated as suggested for CFTR gene.7 Gross genomic rearrangements have to be investigated in situations of refractory molecular diagnosis of Crigler-Najjar disease. Quantitative multiplex PCR of short fluorescent fragments should be developed in UGT1A1 gene analysis in these specific situations.
 |
References
|
|---|
- Bosma PJ, Chowdhury NR, Goldhoorn BG, Hofker MH, Oude Elferink RP, Jansen PL, et al. Sequence of exons and the flanking regions of human bilirubin-UDP-glucurono-syltransferase gene complex and identification of a genetic mutation in a patient with Crigler-Najjar syndrome, type I. Hepatology 1992;15:941-7.[Web of Science][Medline]
- Abeysinghe SS, Chuzhanova N, Krawczak M, Ball EV, Cooper DN. Translocation and gross deletion breakpoints in human inherited disease and cancer I: Nucleotide composition and recombination-associated motifs. Hum Mutat 2003;22:229-44.[CrossRef][Web of Science][Medline]
- Chuzhanova N, Abeysinghe SS, Krawczak M, Cooper DN. Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends. Hum Mutat 2003;22:245-51.[CrossRef][Web of Science][Medline]
- Seppen J, Bosma PJ, Goldhoorn BG, Bakker CT, Chowdhury JR, Chowdhury NR, et al. Discrimination between Crigler-Najjar type I and II by expression of mutant bilirubin uridine diphosphate-glucuronosyltrans-ferase. J Clin Invest 1994;94:2385-91.[Web of Science][Medline]
- Le Bihan-Levaufre B, Francoual J, Labrune P, Chalas J, Capel L, Lindenbaum A. Refinement and role of the diagnosis of Gilbert disease with molecular biology. Ann Biol Clin (Paris) 2001;59:61-6.[Medline]
- Labrune P, Myara A, Hadchouel M, Ronchi F, Bernard O, Trivin F, et al. Genetic heterogeneity of Crigler-Najjar syndrome type I: a study of 14 cases. Hum Genet 1994;94:693-7.[Web of Science][Medline]
- Férec C, Casals T, Chuzhanova N, Macek M Jr, Bienvenu T, Holubova A, et al. Gross genomic rearrangements involving deletions in the CFTR gene: characterization of six new events from a large cohort of hitherto unidentified cystic fibrosis chromosomes and meta-analysis of the underlying mechanisms. Eur J Hum Genet 2006;14:567-76.[CrossRef][Web of Science][Medline]