Published online 2 October 2008
Haematologica, Vol 93, Issue 11, 1678-1685 doi:10.3324/haematol.13102
Copyright © 2008 by Ferrata Storti Foundation
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Garagiola et al. - Supplementary Appendix
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garagiola, I.
Right arrow Articles by Peyvandi, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garagiola, I.
Right arrow Articles by Peyvandi, F.

Original Articles

Nonsense-mediated mRNA decay in the ADAMTS13 gene caused by a 29-nucleotide deletion

Isabella Garagiola1, Carla Valsecchi1, Silvia Lavoretano1, Hale Oren2, Martina Bohm3, Flora Peyvandi1

1 Angelo Bianchi Bonomi Hemophilia and Thrombosis Center, University of Milan, Department of Medicine and Medical Specialities, IRCCS Maggiore Hospital, Mangiagalli and Regina Elena Foundation, Luigi Villa Foundation, Milan, Italy
2 Department of Pediatric Hematology, Dokuz Eylül University Faculty of Medicine, Balçova, Izmir, Turkey
3 Department of Internal Medicine, Johann Wolfgang Goethe University Hospital, Frankfurt am Main, Germany

Correspondence: Flora Peyvandi, Angelo Bianchi, Bonomi Hemophilia and Thrombosis, Centre, University of Milan, Department of Medicine and Medical Specialities, IRCCS Maggiore Hospital, Mangiagalli and Regina Elena Foundation, Luigi Villa Foundation, Milan, Italy. E-mail:flora.peyvandi{at}unimi.it


arrow
ABSTRACT
TOP
 ABSTRACT
Introduction
 Design and Methods
 Results
 Discussion
 References
 
Background: In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts.

Design and Methods: In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay.

Results: In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies.

Conclusions: In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.

Key words: ADAMTS13, in vitro expression study, mRNA expression, nonsense-mRNA decay.


arrow
Introduction
TOP
 ABSTRACT
 Introduction
Design and Methods
 Results
 Discussion
 References
 
Thrombotic thrombocytopenic purpura (TTP) is a severe microangiopathy typically characterized by thrombocytopenia, mechanical hemolytic anemia, neurological and renal manifestations, and fever.1 TTP is associated with a deficiency of von Willebrand factor –cleaving protease and with an increase of uncleaved von Willebrand factor of ultralarge molecular weight.2–4 The protease, designated ADAMTS13 because of its characteristic combination of a disintegrin-like and metalloprotease with thrombospondin type 1 (TSP1) motif, cleaves the platelet adhesive protein von Willebrand factor at the peptide bond Tyr1605 and Met1606.2,5–7 The human ADAMTS13 gene maps to chromosome 9q34 by genome-wide linkage analysis,8 spans 37 kb and comprises 29 exons that encode a polypeptide of 1427 amino acid residues.9,10 ADAMTS13 deficiency may be either congenital, due to mutations in ADAMTS13, or acquired due to neutralizing or non-neutralizing autoantibodies.11–13 Congenital TTP is a rare disorder with undetectable or severely reduced plasma levels of ADAMTS13 as a consequence of mutations in the corresponding gene. To date, more than 80 different mutations have been identified, including missense, nonsense, and splice site alterations as well as nucleotide deletions and insertions spread across ADAMTS13.14 Until now only 30% of the reported mutations have been characterized and analyzed for their consequences on the biosynthesis, secretion and activity of the protease using in vitro-expression studies.15–19 The present study evaluates the molecular mechanism of two mutations observed in the compound heterozygous state in two Turkish siblings with congenital TTP. One mutation, present on the maternal allele, is a single base (A) insertion mutation located within exon 29 (c.4143_4144insA) in the second CUB domain, leading to a frameshift and loss of the last 49 amino acids of the protein.20 The other mutation, located on the paternal allele, is a 29-nucleotide deletion mutation located in exon 3 at codon 291 (c.291_319delGGAGGACACAGA GCGCTATGTGCTCACCA) which causes premature termination codons.21 The main goal of this study was to demonstrate how the premature termination codon introduced by the 29 bp deletion leads to a reduction of ADAMTS13 mRNA levels through such regulatory mechanisms as nonsense-mRNA decay.


arrow
Design and Methods
TOP
 ABSTRACT
 Introduction
 Design and Methods
Results
 Discussion
 References
 
Patients
A Turkish male patient was referred to the Department of Pediatric Hematology of Izmir University at the age of 15 years because of a gastrointestinal infection in association with abdominal pain, fever and vomiting. Five years later, he was admitted to the hospital with purpura, renal failure and decreased platelet counts. Laboratory data on admission were as follows: Coombs-negative hemolytic anemia with schistocytes in the blood smear, hemoglobin 11.7 g/dL, low platelet count (11x109/L, high serum levels of lactate dehydrogenase (1809 UI/L), total bilirubin 2.6 mg/dL and creatinine 4.6 mg/dL. Laboratory results and the clinical symptoms confirmed the diagnosis of TTP. Six additional episodes occurred, usually in association with triggers such as infections or alcohol consumption. He was successfully treated with fresh-frozen plasma (10 mL/kg) and now receives prophylaxis with one infusion every 3 weeks. The patient’s sister developed mild thrombocytopenia and hemolytic anemia at the age of 22 years without an acute episode of TTP up to now.

Measurement of ADAMTS13 activity, ADAMTS13 antigen and anti-ADAMTS13 antibody
ADAMTS13 activity was measured in plasma samples and in the conditioned media of cells transfected by wild type (WT) and mutant expression vectors using the collagen binding assay previously described by Gerritsen et al.22 The lower limit of sensitivity was 6% of ADAMTS13 activity levels in pooled normal plasma taken as the reference standard. ADAMTS13 antigen levels were measured in plasma samples and conditioned media of cells transfected by WT and mutant expression vectors using an enzyme-linked immunosorbent assay previously described by Feys et al.23,24 The presence of anti-ADAMTS13 antibodies was evaluated by western blotting analysis as reported by Peyvandi et al.25 The presence of antibodies neutralizing ADAMTS13 activity was determined as previousy described.21

Genomic sequence analysis
Genomic DNA was isolated from peripheral blood leukocytes.26 The coding regions and intron/exon boundaries of the ADAMTS13 gene (NT_035014) were amplified by polymerase chain reaction (PCR) and sequenced using an automated ABI PRISMTM 310 Genetic Analyzer (Applied Biosystem, Foster City, CA, USA). Details on primers and PCR conditions are available on request. The haplotype was determined using 17 intragenic ADAMTS13 single nucleotide polymorphisms.27

Expression vectors
The complete ADAMTS13 cDNA (kindly provided by Dr. F. Scheiflinger, Baxter Bioscience, Vienna, Austria) was inserted into the mammalian expression vector pcDNATM3.1/V5-His TOPO®TA (Invitrogen, Carlsbad, CA, USA). A further V5 epitope tag was inserted at the N-terminal, next to the prepropeptide of the ADAMTS13 cDNA.

Construction of the ADAMTS13-insA expression vector
The insertion of the adenine (A) at position 4143 of the ADAMTS13 cDNA (NM_139027) was achieved by site-directed mutagenesis of WT expression vector using a QuickChangeTMSite Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) by a forward (5'CTC-TACTGGGAGTCAAGAGAGCAGCCAGGC3') and a reverse primer (5'GCCTGGCTGCTCTCTTGACTC-CCAGTAGAG3'). The presence of the insertion mutation at position 4143 was confirmed by sequence analysis.

Construction and cloning of the ADAMTS13-29del expression vector
The deletion of 29 nucleotides identified in the exon 3 was inserted into the ADAMTS13 cDNA by overlapping PCR: details are provided in an Online Supplementary Appendix 1).

Cell culture and transfection
Human embryo kidney (HEK) 293 cells were maintained in DMEM/F12 (1:1) medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA), antibiotics (100 IU/mL penicillin and 100 mg/mL streptomycin), and glutamine (10%) at 37°C in 5% CO2. Subconfluent HEK293 cells grown in 100-mm culture dishes were transiently transfected with 50 µg of each expression vector using electroporation according to the manufacturer’s instructions (EQUIBIO/Easyject Plus; Thermo Electron Corp, Needham Heights, MA, USA). To normalize the transfection efficiency across a range of individual transfections, the reporter plasmid pRL-TK vector (Promega, Madison, WI, USA) was co-transfected as an internal reference (10:1 molar ratio of test plasmid and pRL-TK). The medium was replaced by Opti-MEM I reduced serum media (Invitrogen, Carlsbad, CA, USA) 24 h after transfection, and cells were incubated for an additional 72 h. Conditioned media of cells transfected by ADAMTS13-WT, ADAMTS13-insA and ADAMTS13-29del expression vectors were collected separately and a protease inhibitor (10% phenylmethylsulfonyl fluoride) was added, clarified by centrifugation and concentrated 30-fold using an AMICON Centricons Column (Millipore, Bedford, MA, USA). Adherent cells were washed with phosphate-buffered saline at pH 7.2 and subsequently lysed with 1 mL of 1x Renilla Luciferase Assay Lysis Buffer (Renilla Luciferase Assay System-Promega, Madison, WI, USA). Untransfected HEK293 cells were used as a negative control.

Western blot analysis
Equivalent volumes of cell lysates and conditioned media of cells transiently transfected by ADAMTS13-WT and ADAMTS13-insA expression vectors, adjusted according to the results of the luciferase assay, were resolved by 7% sodium dodecyl polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions. The ADAMTS13-29del recombinant protein was resolved on a 15% polyacrylamide gel in order to keep its low molecular weight in view (6767 Da). WT and mutant recombinant ADAMTS13 proteins transferred to a pure nitrocellulose membrane (Bio-Rad, Hercules, CA, USA) were detected using an anti-V5 monoclonal antibody against the N-terminal tag of recombinant ADAMTS13 (Invitrogen, Carlsbad, CA, USA) and visualized with peroxidase-labeled anti-mouse immunoglobulin G (Amersham Biosciences, Uppsala, Sweden). Electrochemoluminesce detection reagents (Amersham Biosciences, Uppsala, Sweden) followed by exposure on autoradiographic film were used for the detection.

Immunofluorescence studies
The African green monkey kidney, SV40 virus transformed cell line COS-7 was used. Immunofluorescence experiments were performed as previously reported.17 To detect the cellular localization of WT and mutant ADAMTS13 recombinant proteins, transfected cells were stained simultaneously with anti-V5 antibody and mouse monoclonal antibodies against the protein Bip-GRP78 (a chaperone protein involved in Golgi-endoplasmic reticulum transport) (BD Biosciences, Franklin Lakes, NJ, USA). Images were captured using a Leica DMR epifluorescence microscope (Leica Imaging System, Cambridge, UK) equipped with a CCD camera (Cohu, San Diego, CA, USA) and a specific filter. The images were recorded using QFISH software (Leica Imaging System, Cambridge, UK).

Mini-gene expression vectors
An overlapping PCR technique, as described above with slight modifications, was used to insert exons 4, 5 and 6 including introns 4 and 5 into the ADAMTS13 cDNA in frame with the tag. Two ADAMTS13 mini-gene expression vectors were constructed, one contained the WT exonic and intronic sequences and the other including the 29 bp deletion mutation. The oligonucleotides and PCR conditions are available on request.

mRNA analysis
Subconfluent HEK293 cells grown in 100-mm dishes were transiently transfected with 50 µg of each ADAMTS13-WT and ADAMTS13-29del mini-gene expression vectors. The medium was replaced by Opti-MEM I reduced Serum Media (Invitrogen, Carlsbad, CA, USA) 24 h after transfection, and cells were incubated for an additional 72 h. Cells were washed twice with phosphate-buffered saline, and total RNA was isolated using an RNeasy Mini Kit (QIAGEN, Milan, Italy). To ensure complete removal of DNA contamination, DNase digestion was performed according to the manufacturer’s recommendations. RT-PCR was performed with specific primers spanning from exon 2 to 6 of ADAMTS13 cDNA using an Access RT-PCR System (Promega, Madison, WI, USA).

Real-time RT-PCR
Total RNA of cells transfected with ADAMTS13-WT and ADAMTS13-29del expression vectors with and without intronic regions was isolated using an RNeasy Mini Kit (QIAGEN, Milan, Italy). Primers specific to exons 5 and 6 were used for the analysis: forward 5_-GCTGACCTGGTCCTCTATATCAC-3_, reverse: 5_-AATGGTGACTCCCAGGTCGA-3_. The reference gene was glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and was amplified using GAPDH-forward: 5'-AAAGTGGATATTGTTGCCATCA-3', and GAPDH-reverse: 5'-GGTGGAATCATATTGGAACATG-3'. Chromo4TM Detector was used as the detection system (MJ Research, Waltham, MA, USA). The results were analyzed using the previously described {Delta}Ct comparative method.28


arrow
Results
TOP
 ABSTRACT
 Introduction
 Design and Methods
 Results
Discussion
 References
 
ADAMTS13 antigen and activity
Table 1 reports the ADAMTS13 antigen and activity levels of both siblings and their parents. The siblings had severe ADAMTS13 deficiency, while their parents had moderately reduced plasma levels of ADAMTS13 antigen and activity. No anti-ADAMTS13 antibodies were detectable in the patients’ plasma.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		Table 1. ADAMTS13 phenotypes and genotypes of the two Turkish siblings affected by congenital thrombotic thrombocytopenic purpura and their parents.

Genomic sequence analysis
Sequence analysis of the ADAMTS13 gene identified two genetic defects in the heterozygous state in the siblings. The first mutation was a deletion of 29 nucleotides located at exon 3 (c.291_319delGGAGGA CACAGAGCGCTATGTGCTCACCA) causing a frameshift with premature termination codons in the metalloprotease domain.21 The second mutation was an insertion of an adenine (A) at 4143_4144 codon in the second CUB domain, which introduced a premature termination at codon 1381 causing the loss of the last 49 amino acids at the C-terminus of ADAMTS13.20 Table 1 reports the ADAMTS13 gene mutations observed in both patients and their parents.

Haplotype analysis showed that both probands were carriers of the same haplotype linked to the 4143–4144insA mutation, previously reported by Schneppenheim.27

ADAMTS13 activity and antigen in conditioned media
ADAMTS13 antigen levels in conditioned media of cells transiently transfected by ADAMTS13-insA and ADAMTS13-29del were 3.7±1.6% and undetectable, respectively, in comparison with the level of ADAMTS13-WT taken as 100% (Table 2). The reduced amounts of ADAMTS13-insA released into the conditioned media showed an ADAMTS13 activity of 10±3.7%, compared to the ADAMTS13-WT level (the mean value of ADAMTS13-WT was set as 100%) (Table 2).


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		Table 2. ADAMTS13 activity (CBA) and antigen levels in the conditioned media of cells transiently transfected by ADAMTS13-WT, ADAMTS13-insA and ADAMTS13-29del expression vectors.

Western blot analysis
Western blot analysis performed on conditioned media and lysates of cells transfected with the ADAMTS13-WT expression vector showed a band with a molecular weight of approximately 190 kDa (Figure 1). The band was not detectable in the medium of untransfected cells used as a negative control. The lysate of cells transfected by ADAMTS13-insA expression vector showed a band with a lower molecular weight than that of ADAMTS13-WT, which reflects the loss of the last 49 amino acids at the C-terminus of ADAMTS13. Interestingly, no band was observed in the conditioned media of cells transfected by the ADAMTS13-insA expression vector, suggesting the retention of the ADAMTS13-insA recombinant protein (Figure 1A). The ADAMTS13-29del recombinant protein was not detectable in the conditioned media and cell lysates, even when a higher concentration of poly-acrylamide gel (15%) was used (Figure 1B).


Figure 1931678
View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Western blot analysis of recombinant ADAMTS13 proteins. The ADAMTS13-WT and mutant expression vectors were transiently expressed in HEK293 cells. (A) ADAMTS13-WT and ADAMTS13-insA recombinant proteins in the conditioned media and cell lysates on 7% SDS-PAGE. (B) ADAMTS13-WT and ADAMTS13-29del recombinant proteins in the conditioned media and cell lysates on 15% SDS-PAGE. WT and mutant ADAMTS13 recombinant proteins were detected using an anti-V5 monoclonal antibody against the N-terminal tag of recombinant proteins. Negative controls were HEK293 untransfected cells.

Immunofluorescence studies
Different patterns of localization of recombinant ADAMTS13-WT and ADAMTS13-insA were observed. ADAMTS13-WT was mainly localized in the perinuclear area (Figure 2). In contrast, ADAMTS13-insA was diffusely present throughout the cytoplasm with no perinuclear enhancement, probably consistent with a subcellular localization in the endoplasmic reticulum (Figure 2). Merge fluorescent studies demonstrated the co-localization of ADAMTS13-insA recombinant protein with a BiP-endoplasmic reticulum marker confirming the hypothesis of the retention of recombinant protein in the endoplasmic reticulum (Figure 3). For cells transfected with ADAMTS13-29del expression vector, immunofluorescence studies revealed that the mutant recombinant protein stained much more faintly than ADAMTS13-WT (Figure 2).


Figure 2931678
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Immunofluorescence studies of the recombinant ADAMTS13 proteins in COS-7 cells.


Figure 3931678
View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Merge immunofluorescence studies of ADAMTS13-WT and ADAMTS13-insA recombinant proteins. COS-7 cells transfected with WT and mutant constructs stained simultaneously with anti-V5 monoclonal antibody against recombinant ADAMTS13 (green) and anti-Bip-GRPp78 monoclonal antibody (red) against a chaperone protein of the endoplasmic reticulum compartment.

mRNA analysis
Since the 29 bp deletion mutation causes a frameshift in the reading frame introducing premature termination codons, reverse transcription PCR (RT-PCR) was performed to evaluate whether this mutation affects the ADAMTS13 mRNA splicing process. Total RNA extracted from HEK293 cells transiently transfected by ADAMTS13-WT and ADAMTS13-29del mini-genes were used as templates for the RT-PCR using specific primers from exon 2 to 6 of ADAMTS13 cDNA. The RT-PCR products of ADAMTS13-WT and mutant mRNA showed two bands of 358 bp and 329 bp, respectively (Figure 4). No aberrantly spliced products were observed for mutant ADAMTS13 mRNA confirming that the 29 bp deletion mutation shows normal splicing as also demonstrated by sequencing.


Figure 4931678
View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. RT-PCR analysis of ADAMTS13-WT and mutant mini-genes. RT-PCR products on 2% agarose gel amplified from total RNA extracted from HEK293 cells transfected with ADAMTS13-WT and ADAMTS13-29del minigenes.

Real-time RT-PCR
In order to analyze whether the premature termination codon introduced by the 29 bp deletion mutation interferes with ADAMTS13 mRNA expression levels, real-time RT-PCR studies were performed on total RNA isolated from HEK293 cells transiently transfected by ADAMTS13-WT and ADAMTS13-29del mini-genes. It was observed that the levels of expression of ADAMTS13-29del mRNA were reduced by approximately 70% in comparison with those of ADAMTS13-WT. These findings indicate that the ADAMTS13-29del mRNA bearing the premature termination codon was most likely undergoing nonsense-mediated mRNA decay (Figure 5). In order to elucidate the role played by introns in the nonsense-mediated decay mechanism, kinetics of different ADAMTS13 mRNA were evaluated in a transient transfection system using ADAMTS13-WT and ADAMTS13-29del expression vectors with no introns. This experiment showed a decrease of only 15% of steady state ADAMTS13-29del mRNA compared to ADAMTS13-WT (Figure 5) indicating that the premature termination codon introduced by the 29del mutation associated with the introns negatively affected the steady state of ADAMTS13 mRNA levels, perhaps triggering the nonsense-mRNA decay mechanisms.


Figure 5931678
View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. Real-time RT-PCR results on total RNA from ADAMTS13-WT and ADAMTS13-29del minigenes. Results of real-time RT-PCR of ADAMTS13-WT and ADAMTS13-29del without introns and ADAMTS13-WT and ADAMTS13-29del plus introns. All data are compared to ADAMTS13-WT cDNA as a calibrator sample and expressed as percentages of ADAMTS13-WT (mean±SE) obtained in three independent assays.


arrow
Discussion
TOP
 ABSTRACT
 Introduction
 Design and Methods
 Results
 Discussion
References
 
We report the identification of two mutations in a heterozygous state causing a severe deficiency of ADAMTS13 in two Turkish siblings: a 29-nucleotide deletion mutation located in exon 3 (c.291_319del GGAGGACACAGAGCGCTATGTGCTCACCA) and a single base (A) insertion mutation located in exon 29 (c.4143_4144insA) in the second CUB domain.20,21 With regards to the 29bp deletion mutation, we evaluated whether a regulatory mechanism, known as nonsense-mediated mRNA decay, could have any role in the level of expression of ADAMTS13 mRNA.

As reported in mammalian cells, nonsense-mediated mRNA decay is an intron-dependent biological mechanism responsible for depleting mRNA containing premature termination codons, presumably to control the synthesis of abnormal proteins deleterious to cellular metabolism.29–31 Not all premature termination codon -bearing mRNA derived from genes containing introns are unstable. They lose stability only when the premature termination codon is located at 5' of the last intron by about 55 or more nucleotides.32–34 We hypothesized that the premature termination codon introduced by the 29 bp deletion mutation would lead to unstable ADAMTS13 mRNA triggering the destruction of the premature termination codon bearing ADAMTS13 mRNA. First we demonstrated that the 29bp deletion mutation does not affect the ADAMTS13 mRNA splicing process. We subsequently evaluated the levels of expression, using ADAMTS13-WT and mutant mini-genes, by a real-time RT-PCR technique. The expression of ADAMTS13-29del mRNA was approximately 70% lower than that of ADAMTS13-WT, indicating that the 29 bp deletion mutation negatively affects the steady state of mRNA levels.

To confirm that the nonsense-mediated decay mechanism is intron dependent, kinetic studies of ADAMTS13 mRNA using ADAMTS13-WT and ADAMTS13-29del expression vectors without introns were carried out. These experiments showed a decrease of approximately 15% of steady state ADAMTS13-29del mRNA using expression vectors with no introns, demonstrating that the premature termination codon introduced by the 29del mutation associated with introns negatively affects the expression level of ADAMTS13 mRNA, probably triggering the nonsense-mRNA decay mechanism. To summarize, the premature termination codon introduced by the 29 bp deletion mutation triggers a decay process reducing the expression of ADAMTS13 mRNA which probably affects the level of ADAMTS13 protein.

In the in vitro-expression studies, the ADAMTS13-29del recombinant protein was undetectable in conditioned media and cell lysates using western blot analysis. On the other hand immunofluorescence studies revealed that the ADAMTS13-29del recombinant protein is synthesized in small amounts as a short peptide (6767 Da) which is probably not functional and easily degradable. The lack of detection of the ADAMTS13-29del recombinant protein in the western blots could probably be explained by the recombinant protein having lost the V5-tag when the cells were lysed.

With regard to the second gene variation, the 4143_4144insA mutation located in the second CUB domain, our in vitro expression studies confirmed that the 4143_4144insA mutation impairs the secretion pathway associated with intracellular accumulation. The defect may be due to the removal of the central β-strands present in the CUB domain, resulting in the destruction of its architecture, as previously described by Pimanda.18 Eight different mutations in the first and second CUB domain were reported previously and some were analyzed by in vitro-expression studies, suggesting, consistently with our results, that the CUB domains play a critical role in the biosynthesis and secretion of ADAMTS13.8,35,36

The 4143_4144insA mutation has been frequently detected in patients with hereditary ADAMTS13 deficiency in northern and central European countries. Schneppenheim and colleagues, after analyzing the segregation of 4143_4144insA mutation using 17 intragenic polymorphic markers in patients and their relatives, suggested that 4143_4144insA is a founder mutation most probably derived from a common ancestor in central Europe.27 The identification of the ADAMTS13 haplotype linked to the 4143_4144insA mutation in our probands from Turkey is consistent with the hypothesis of a common ancestor in central Europe. This could also be due to immigration from central Europe to Turkey when, in the latter part of the 19th century, the Ottoman Empire received refugees, particularly Hungarian and Poles, from the Hasburg Empire. Furthermore Turkey also became a country of refuge for approximately 100,000 Jews from German-occupied Europe who made Turkey their country of first asylum. Hence, it is reasonable to consider that the 4143_4144insA mutation in our Turkish patients reflects a history of trading and migration between countries, which has served as a vehicle for gene flow.

In conclusion, this work demonstrates that the two cases of severe ADAMTS13 deficiency that we studied are mechanistically caused by the association of two different gene defects acting at two different levels: the impairment of steady state mRNA levels caused by a premature termination codon-mediated decay mechanism induced by a 29 bp deletion, and alteration of the secretion pathway caused by the 4143_4144insA mutation.


arrow
Acknowledgments
 
The authors thank Dr. Maria Teresa Canciani and Maria Teresa Baietta (Angelo Bianchi Bonomi Hemophilia and Thrombosis Center, Maggiore Hospital Mangiagalli, Regina Elena Foundation, and University of Milan, Milan, Italy) for measuring ADAMTS13 enzymatic activity and antigen and Luigi Ghilardini (Angelo Bianchi Bonomi Hemophilia and Thrombosis Center, Maggiore Hospital Mangiagalli, Regina Elena Foundation, and University of Milan, Milan, Italy) for the figures.


arrow
Footnotes
 
Funding: this work was partially supported by grants from the Fondazione Cariplo and Fondazione Italo Monzino.

The online version of this article contains a supplementary appendix.

Authorship and Disclosures

IG, CV and SL performed the experiments; IG and FP designed the research, analyzed the results and wrote the paper. Other authors provided samples and clinical data. The authors report no potential conflicts of interest.

Received for publication March 25, 2008. Revision received June 24, 2008. Accepted for publication July 16, 2008.


arrow
References
TOP
 ABSTRACT
 Introduction
 Design and Methods
 Results
 Discussion
 References
 
  1. Moake JL. Thrombotic microangiopathies. N Engl J Med 2002;347:589-600.[Free Full Text]
  2. Furlan M, Robles R, Läemmle B. Partial purification and characterization of a protease from human plasma cleaving von Willebrand factor to fragments produced by in vivo proteolysis. Blood 1996;87:4223-34.[Abstract/Free Full Text]
  3. Furlan M, Robles R, Solenthaler M, Wassmer M, Sandoz P, Lämmle B. Deficient activity of von Willebrand factor-cleaving protease in chronic relapsing thrombotic thrombocytopenic purpura. Blood 1997;89:3097-103.[Abstract/Free Full Text]
  4. Furlan M, Robles R, Galbusera M, Remuzzi G, Kyrle PA, Brenner B, et al. von Willebrand factor-cleaving protease in thrombotic thrombocytopenic purpura and the hemolyticuremic syndrome. N Engl J Med 1998;339:1578-84.[Abstract/Free Full Text]
  5. Dent JA, Berkowitz SD, Ware J, Kasper CK, Ruggeri ZM. Identification of a cleavage site directing the immunochemical detection of molecular abnormalities in type IIA von Willebrand factor. Proc Natl Acad Sci USA 1990;87:6306-10.[Abstract/Free Full Text]
  6. Fujikawa K, Suzuki H, McMullen B, Chung D. Purification of human von Willebrand factor-cleaving protease and its identification as a new member of the metalloproteinase family. Blood 2001;98:1662-6.[Abstract/Free Full Text]
  7. Tsai HM. Physiologic cleavage of von Willebrand factor by a plasma protease is dependent on its conformation and requires calcium ion. Blood 1996;87:4235-44.[Abstract/Free Full Text]
  8. Levy GG, Nichols WC, Lian EC, Foroud T, McClintick JN, McGee BM, et al. Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic pur pura. Nature 2001;413:488-94.[CrossRef][Web of Science][Medline]
  9. Gerritsen HE, Robles R, Lämmle B, Furlan M. Partial amino acid sequence of purified von Willebrand factor-cleaving protease. Blood 2001;98:1654-61.[Abstract/Free Full Text]
  10. Zheng X, Chung D, Takayama TK, Majerus EM, Sadler JE, Fujikawa K. Structure of von Willebrand factor-cleaving protease (ADAMTS13), a metalloprotease involved in thrombotic thrombocytopenic purpura. J Biol Chem 2001;276:41059-63.[Abstract/Free Full Text]
  11. Kokame K, Miyata T. Genetic defects leading to hereditary thrombotic thrombocytopenic purpura. Semin Hematol 2004;41:34-40.[CrossRef][Web of Science][Medline]
  12. Furlan M, Robles R, Solenthaler M, Lämmle B. Acquired deficiency of von Willebrand factor-cleaving protease in a patient with thrombotic thrombocytopenic purpura. Blood 1998;91:2839-46.[Abstract/Free Full Text]
  13. Tsai HM, Lian EC. Antibodies to von Willebrand factor-cleaving protease i n acute thrombotic thrombocytopenic purpura. N Engl J Med 1998;339:1585-94.[Abstract/Free Full Text]
  14. Tsai HM. Current concepts in thrombotic thrombocytopenic purpura. Annu Rev Med 2006;57:419-36.[CrossRef][Web of Science][Medline]
  15. Kokame K, Matsumoto M, Soejima K, Yagi H, Ishizashi H, Funato M, et al. Mutations and common polymorphisms in ADAMTS13 gene responsible for von Willebrand factor-cleaving protease activity. Proc Natl Acad Sci USA 2002;99:11902-7.[Abstract/Free Full Text]
  16. Matsumoto M, Kokame K, Soejima K, Miura M, Hayashi S, Fujii Y, et al. Molecular characterization of ADAMTS13 gene mutations in Japanese patients with Upshaw-Schulman syndrome. Blood 2003;103:1305-10.[CrossRef][Web of Science][Medline]
  17. Peyvandi F, Lavoretano S, Palla R, Valsecchi C, Merati G, De Cristofaro R, et al. Mechanisms of the interaction between two ADAMTS13 gene mutations leading to severe deficiency of enzymatic activity. Hum Mutat 2006;27:330-6.[CrossRef][Web of Science][Medline]
  18. Pimanda JE, Maekawa A, Wind T, Paxton J, Chesterman CN, Hogg PJ. Congenital thrombotic thrombocytopenic purpura in association with a mutation in the second CUB domain of ADAMTS13. Blood 2004;103:627-9.[Abstract/Free Full Text]
  19. Uchida T, Wada H, Mizutani M, Iwashita M, Ishihara H, Shibano T, et al. Identification of novel mutations in ADAMTS13 in an adult patient with congenital thrombotic thrombocytopenic purpura. Blood 2004;104:2081-3.[Abstract/Free Full Text]
  20. Schneppenheim R, Budde U, Oyen F, Angerhaus D, Aumann V, Drewke E, et al. von Willebrand factor cleaving protease and ADAMTS13 mutations in childhood TTP. Blood 2003;101:1845-50.[Abstract/Free Full Text]
  21. Peyvandi F, Ferrari S, Lavoretano S, Canciani MT, Mannucci PM. von Willebrand factor cleaving protease ADAMTS-13)(and ADAMTS-13 neutralizing autoantibodies in 100 patients with thrombotic thrombocytopenic purpura. Br J Haematol 2004;27:433-9.
  22. Gerritsen HE, Turecek PL, Schwarz HP, Lämmle B, Furlan M. Assay of von Willebrand factor (vWF)-cleaving protease based on decreased collagen binding affinity of degraded vWF: a tool for the diagnosis of thrombotic thrombocytopenic purpura (TTP). Thromb Haemost 1999;82:1386-9.[Web of Science][Medline]
  23. Feys HB, Liu F, Dong N, Pareyn I, Vauterin S, Vandeputte N, et al. ADAMTS-13 plasma level determination uncovers antigen absence in acquired thrombotic thrombocytopenic purpura and ethnic differences. J Thromb Haemost 2006;4:955-62.[CrossRef][Web of Science][Medline]
  24. Feys HB, Canciani MT, Peyvandi F, Deckmyn H, Vanhoorelbeke K, Mannucci PM. ADAMTS13 activity to antigen ratio in physiological and pathological conditions associated with an increased risk of thrombosis. Br J Haematol 2007;138:534-40.[CrossRef][Web of Science][Medline]
  25. Peyvandi F, Lavoretano S, Palla R, Feys HB, Vanhoorelbeke K, Battaglioli T, et al. ADAMTS13 and anti-ADAMTS13 antibodies as markers for recurrence of acquired thrombotic thrombocytopenic purpura during remission. Haematologica 2008;93:232-9.[Abstract/Free Full Text]
  26. Miller I, Djkes DD. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acid Res 1988;16:1215-20.[Free Full Text]
  27. Schneppenheim R, Kremer Hovinga JA, Becker T, Budde U, Karpman D, Brockhaus W, et al. A common origin of the 4143insA ADAMTS13 mutation. Thromb Haemost 2006;96:3-6.[Web of Science][Medline]
  28. Peyvandi F, Garagiola I, Palla R, Marziliano N, Mannucci PM. Role of the 2 adenine (g.11293_11294insAA) insertion polymorphism in the 3' untranslated region of the factor VII (FVII) gene: molecular characterization of a patient with severe FVII deficiency. Hum Mutat 2005;26:455-61.[CrossRef][Web of Science][Medline]
  29. Cheng J, Maquat LE. Nonsense codons can reduce the abundance of nuclear mRNA without affecting the abundance of pre-mRNA or the half-life of cytoplasmic mRNA. Mol Cell Biol 1993;13:1892-902.[Abstract/Free Full Text]
  30. Maquat LE. When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells. RNA 1995;1:453-65.[Abstract]
  31. Maquat LE. Nonsense-mediated mRNA decay in mammals. J Cell Sci 2005;118:1773-6.[Free Full Text]
  32. Byers PH. Killing the messenger: new insights into nonsense-mediated mRNA decay. J Clin Invest 2002;109:3-6.[CrossRef][Web of Science][Medline]
  33. Cheng J, Belgrader P, Zhou X, Maquat LE. Introns are cis effectors of the nonsense-codon-mediated reduction in nuclear mRNA abundance. Mol Cell Biol 1994;14:6317-25.[Abstract/Free Full Text]
  34. Zhang J, Sun X, Qian Y, La Duca JP, Maquat LE. At least one intron is required for the nonsense-mediated decay of triosephosphate isomerase mRNA: a possible link between nuclear splicing and cytoplasmic translation. Mol Cell Biol 1998;18:5272-83.[Abstract/Free Full Text]
  35. Antoine G, Zimmermann K, Plaimauer B, Grillowitzer M, Studt JD, Lämmle B, et al. ADAMTS13 gene defects in two brothers with constitutional thrombotic thrombocytopenic purpura and normalization of von Willebrand factor-cleaving protease activity by recombinant human ADAMTS13. Br J Haematol 2003;120:821-4.[CrossRef][Web of Science][Medline]
  36. Licht C, Stapenhorst L, Simon T, Budde U, Schneppenheim R, Hoppe B. Two novel ADAMTS13 gene mutations in thrombotic thrombocytopenic purpura/hemolyticuremic syndrome (TTP/HUS). Kidney Int 2004;66:955-8.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
 haematolHome page
M. Galbusera, M. Noris, and G. Remuzzi
Inherited thrombotic thrombocytopenic purpura
Haematologica, February 1, 2009; 94(2): 166 - 170.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Garagiola et al. - Supplementary Appendix
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garagiola, I.
Right arrow Articles by Peyvandi, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garagiola, I.
Right arrow Articles by Peyvandi, F.