Acute Myeloid Leukemia |
1 Department of Haematology, School of Medicine, Cardiff University, Cardiff, South Glamorgan and
2 Center for Cancer Research and Cell Biology, Queens University Belfast, Lisburn Belfast, UK
Correspondence: Elisabeth Walsby, Dept. of Haematology, School of Medicine, Cardiff University, Heath Park, Cardiff, South Glamorgan, CF14 4XN, Wales, UK. E-mail: walsbyej{at}cf.ac.uk
|
|
|---|
Design and Methods: Aurora kinase gene expression profiles were assessed in 101 samples from patients with acute myeloid leukemia. Subsequently, aurora kinase inhibitors were investigated for their in vitro effects on cell viability, histone H3 phosphorylation, cell cycle and morphology in acute myeloid leukemia cell lines and primary acute myeloid leukemia samples.
Results: The aurora kinase inhibitors AZD1152-HQPA and ZM447439 induced growth arrest and the accumulation of hyperploid cells in acute myeloid leukemia cell lines and primary acute myeloid leukemia cultures. Furthermore, both agents inhibited histone H3 phosphorylation and this preceded perturbations in cell cycle and the induction of apoptosis. Single cell cloning assays were performed on diploid and polyploid cells to investigate their colony-forming capacities. Although the polyploid cells showed a reduced capacity for colony formation when compared with their diploid counterparts, they were consistently able to form colonies.
Conclusions: AZD1152-HQPA- and ZM447439 are effective apoptosis-inducing agents in acute myeloid leukemia cell lines and primary acute myeloid leukemia cultures. However, their propensity to induce polyploidy does not inevitably result in apoptosis.
Key words: aurora kinase, leukemia, cell cycle, hyperploid.
|
|
|---|
The aim of this study was to assess the level of expression of the aurora kinases in primary AML blasts and to determine the effects of two aurora kinase inhibitors, AZD1152-HQPA and ZM447439, on myeloid cell lines and primary samples from patients with AML.
|
|
|---|
Cell imaging
Cytospin preparations of cell lines treated with the aurora kinase inhibitors at 0.01 µM were prepared, stained with modified Wrights stain and viewed by light microscopy.
Cell viability and cell counting
Cell viability was measured by trypan blue exclusion, and the expansion of cultures was quantified by manual cell counting using a hemocytometer on sequential days in culture following treatment of cell lines with AZD1152-HQPA and ZM447439 at concentrations of 1.0, 0.1 and 0.01 µM.
Annexin V positivity
Annexin V positivity was determined in treated cells using the Alexis Biochemicals Annexin V-FITC Apoptosis Detection Kit (Axxora (UK) Ltd., Nottingham, UK) according to the manufacturers instructions. Briefly, following treatment for 48 hours with the inhibitors the cells were washed in phosphate-buffered saline (PBS) and resuspended in the supplied binding buffer containing calcium chloride and incubated with annexin V-fluoroscein-isothiocyanate (FITC) in the dark for 10 minutes. Untreated samples were also prepared in this manner. Cells were then washed with PBS and resuspended in the supplied binding buffer and 1 µg/mL propidium iodide (Sigma) added. Data on the annexin V positivity of the cells were collected on a FACScalibur and analyzed using WinMDI software.
Histone H3 phosphorylation status and cell cycle analysis
The phosphorylation status of histone H3 was determined by flow cytometry. Cell lines and primary cells were treated with 0.1 µM and 0.01 µM concentrations of both inhibitors for 24 and 48 hours alongside untreated control cultures of the same cells. After 24 and 48 hours the cells were harvested by centrifugation, washed in PBS, resuspended by vortexing in ice-cold 70% ethanol and stored at –20°C until analysis. Cells were rehydrated with 0.5 mL PBS (Invitrogen Ltd.) with 1% bovine serum albumin (PBS/BSA; Sigma) and centrifuged to remove residual ethanol. Cells were then resuspended in 200 µL PBS/BSA with 0.25% Triton X100 (Sigma) and incubated on ice for 20 minutes. A washing step with 0.5 mL PBS/BSA was performed and the cells were incubated overnight in 400 µL PBS/BSA and anti-phospho histone H3 antibody (Upstate Cell Signaling Solutions, Lake Placid, NY, USA) at 4°C. Following the overnight incubation, cells were washed with PBS/BSA and incubated with FITC-goat anti-rabbit secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) in PBS/BSA for 1 hour in the dark at 4°C. Cells were washed with PBS/BSA and resuspended in 50 µL (10 µg/mL) propidium iodide and 10 µg/mL RNase (Sigma). Fluorescence data on the cells were collected using a FACScalibur (BD UK Ltd., Cowley, Oxfordshire, UK) and analyzed using WinMDI software. Cell cycle analysis was performed using Cylchred software. This software was used to determine the percentage of cells in the sub-G1 (<G1), G1, S, G2, and greater than G2 (>G2) regions of the cell cycle.
Gene expression analysis
Expression levels of aurora kinases A, B and C were validated by quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) which was performed on 101 patients samples. Primers used for RQ-PCR were:
AuroraAR 5 ACTGACCACCCAAAATCTGC 3
AuroraAL 5 TGGAATATGCACCACTTGGA 3
AuroraBR 5 GGCGATAGGTCTCGTTGTGT 3
AuroraBL 5GGGAGAGCTGAAGATTGCTG 3
AuroraCR 5ACCAGCCAAAATCTTGCAATC 3
AuroraCL 5 GAATATGCTCCAAGGGGTGA 3
Clonogenicity assays in treated cell lines
AML cell lines were treated with the aurora kinase inhibitors (0.01 µM) for 48 hours before being washed and re-plated into fresh medium. Polyploid cells were distinguished on the basis of their forward scatter and side light scatter characteristics; being larger than diploid cells in the untreated cell populations derived from the same cell line. Clumps of cells were discriminated from genuine polyploidy by using pulse width (time of flight) through the laser beam. Polyploid cells were sorted such that one cell was introduced into each well of a 96-well plate. Untreated cells of each cell line were also sorted in the same manner to act as a control for any effects of the cell sorting process. The treated and untreated control cells placed into the 96-well plates were incubated at 37°C in 5% CO2 for 7 days before an assessment of colony formation (>50 cells) or clusters (>5 cells, <50 cells) by light microscopy.
|
|
|---|
|
View this table: [in a new window] [Download PPT slide] |
Table 1. Gene expression levels of aurora kinases in AML patients as determined by quantitative RT-PCR.
|
![]() View larger version (38K): [in a new window] [Download PPT slide] |
Figure 1. Morphological evidence of the changes in NB4 cells as a result of treatment with aurora kinase inhibitors. (A) Untreated NB4 cells. (B) NB4 cells treated with AZD1152-HQPA (0.01 µM) for 48 hours and (C) NB4 cells treated with ZM447439 (0.01 µM) for 48 hours. All images are at 40X magnification. Sizes of untreated NB4 cells (red) and cells treated with 0.01 µM AZD1152-HQPA (black) for (D) 24 hours, (E) 48 hours and (F) 72 hours measured by forward light scatter using flow cytometry. The same pattern of increasing cell size with treatment was only observed when NB4 cells were treated with ZM447439 at 1.0µM, while lower concentrations had no effect on cell size. Data are representative of three repetitions of this experiment.
|
![]() View larger version (41K): [in a new window] [Download PPT slide] |
Figure 2. The effect on cell cycle resulting from treatment with varying concentrations of aurora kinase inhibitors for 48 hours was assessed using cylchred software. (A) The distribution of six myeloid cell lines assayed in triplicate and (B) primary cells from 30 AML patients treated with the indicated concentrations of AZD1152-HQPA and ZM447439 are shown in the histograms. *Denotes a change in cell cycle distribution that is significantly different from that in the untreated population (p<0.05) measured using a paired t test. Error bars indicate ± one standard deviation.
|
Effect of AZD1152-HQPA and ZM447439 on the proliferative capacity of cell lines
AZD1152-HQPA, at concentrations as low as 0.01 µM, produced a significant (p
0.05) decrease in the ability of NB4 cells to proliferate by 48 hours (Figure 3). The other cell lines (HL-60, NB4R2, K562, KG1 and U937) also showed reduced proliferative capacity following treatment with AZD1152-HQPA. The viability of the NB4 cells was decreased at 48 hours by treatment with 0.01 µM AZD1152-HQPA (p
0.05). The other cell lines also showed decreases in viability following treatment with AZD1152-HQPA. ZM447439 induced a significant decrease in the proliferative capacity at the higher concentration of 1.0 µM in NB4 cells after 24 hours (Figure 3) and the viability of NB4 cells was reduced after 48 hours with 1.0 µM ZM447439. Similar effects were seen on the other cell lines (NB4R2, KG1, K562, HL60 and U937), which also showed reduced proliferation following treatment with ZM447439. Annexin V expression was measured in NB4 cells following treatment with the inhibitors for 48 hours. The results presented in Online Supplementary Figure S2 show that apoptosis was induced in the cells in a concentration-dependent manner.
![]() View larger version (26K): [in a new window] [Download PPT slide] |
Figure 3. NB4 cells were treated with concentrations of AZD1152-HQPA and ZM447439 between 1.0 µM and 0.01 µM for 72 hours. The growth and viability of the cells were recorded at 24 hour intervals to assess the effect of the aurora kinase inhibitors on the cells. Experiments were repeated in triplicate. All concentrations of AZD1152-HQPA used proved to be effective at reducing the growth and viability of the NB4 cells while only the highest concentration of ZM447439 resulted in the same effect on the NB4 cells.
|
![]() View larger version (32K): [in a new window] [Download PPT slide] |
Figure 4. The effect of treatment with AZD1152-HQPA and ZM447439 on phosphorylation of histone H3 in NB4 cells. (A) Flow cytometry was used to determine the percentage of cells with phosphorylated histone H3. Doublets were removed from the analysis using the R1 gate shown in the first plot. The remaining plots show propidium iodide staining, used to demonstrate the DNA content of the cells against the level of phosphorylated histone H3 for each cell measured. At 48 hours, the untreated population had 2.45% phosphorylated histone H3 (center) and AZD1152-HQPA -treated cells (0.01 µM) 2.08% (right) shown in the R2 region on these plots. (B) The effect of different concentrations of AZD1152-HQPA and ZM447439 over 48 hours on a range of six cell lines and primary cells from 30 AML patients was determined by flow cytometry. A significant difference (p<0.05) in phosphorylation state compared to that of the untreated control population is indicated by * and was determined using paired t tests.
|
Clonogenic potential of aurora kinase-induced polyploid cells
Polyploid cells induced by a single 48-hour exposure to aurora kinase inhibitors (0.01 µM) were isolated by high-speed cell sorting directly into 96-well plates containing culture media (one cell per well). Cell lines treated with AZD1152-HQPA or ZM447439 showed reduced colony-forming ability compared with that of the untreated control cells. The average colony growth across all the cell lines was reduced from 391 colonies to 134 colonies when the cells were treated with AZD1152-HQPA (p=0.003) and to 154 colonies when they were treated with ZM447439 (p=0.022). The numbers of colonies grown following treatment and re-plating in fresh medium are shown in Figure 5.
![]() View larger version (31K): [in a new window] [Download PPT slide] |
Figure 5. The effect of plating six myeloid cell lines (HL-60, U937, NB4, NB4R2, KG1 and K562) treated with aurora kinase inhibitors AZD1152-HQPA and ZM447439 (0.01 µM) for 48 hours into fresh medium was assessed by counting the number of colonies of cells that had grown after 1 week from cells plated into culture dishes as single cells per well. The experiments were repeated in triplicate and statistical significance was determined using a paired t test: *p=0.003 and *p=0.022 for AZD1152-HQPA and ZM447439 compared to untreated, respectively.
|
|
|
|---|
This study is the first report of aurora kinase expression levels in patients with AML. We found that aurora kinase A was expressed in 37% of primary AML samples, while aurora kinase B was only expressed in 10% of such samples. The low mitotic rate of AML cells in in vitro culture may be one reason why only some of the population were found to express these kinases. Interestingly, there appeared to be a correlation between aurora kinase expression and FAB group, with the M3 subtype predominantly exhibiting aurora kinase A expression, while the M4 subtype usually had very low expression of both aurora kinase A and aurora kinase B. The expression of the aurora kinases in a range of cancers (breast, ovarian, colon, prostate, neuroblastoma and cervical cancer cells)6–10 in which expression was correlated with tumor progression suggested that aurora kinases may be a potential target for treatment. However, given the levels of expression in primary AML cells, probably only a sub-group of patients might be responsive to aurora kinase therapy. Although no correlation was seen between expression of the aurora kinases and response to their inhibition, there are various possible explanations for this. Our favored hypothesis is that a critical level of aurora kinase expression is required to maintain cell viability, meaning that cells with lower aurora kinase expression may be more susceptible to aurora kinase inhibition; this hypothesis does, however, need to be tested experimentally. Proliferating cells express aurora kinase A and B and aurora kinase A is required for the commitment of human cells to mitosis.3 Most previous studies3,15–17,28–30 were conducted on solid tumors and not on circulating blast cells. The effects of inhibiting the aurora kinases in different types of cancer suggest that aurora kinase inhibitors trigger apoptosis in a proportion of cells and lead to arrest of tumors in model systems.18 In our studies, both AZD1152-HQPA and ZM447439 resulted in a decreased proliferative capacity and viability of AML cell lines. This agrees with the findings of previous studies in which ZM447439 inhibited proliferation completely and resulted in endoreduplication in human cell lines.15 Another aurora kinase inhibitor, VX680, also inhibited proliferation and leukemic cells were found to be particularly sensitive to this inhibitor.17
Treatment of the cell lines and primary AML material with the inhibitors AZD1152-HQPA and ZM447439 resulted in the disruption of the cell cycle with accumulation of cells with 4N and >4N DNA content, alongside a decrease in the proportion of cells with <4N DNA content. In agreement with the data described here, ZM447439 has previously been reported to result in accumulation of cells with 4N DNA content in a variety of human cell lines (A549, MCF-7, DLD-1, HeLa and U2OS).15 There was also an accumulation of polyploid cells as a result of treatment with VX-680.5,17
Histone H3 phosphorylation is controlled by the aurora kinases and is important for chromosome condensation.5,6,13 When histone H3 phosphorylation is inhibited, chromosome condensation is prevented and entry to mitosis blocked. Histone H3 phosphorylation was measured as a means of determining whether the aurora kinase inhibitors AZD1152-HQPA and ZM447439 had an effect on the cells. However, the level of histone H3 phosphorylation seen in the primary AML cells was low (~2%) even in the absence of inhibitors. In our study, phosphorylation of histone H3 was reduced in cell lines after treatment with AZD1152-HQPA and ZM447439. This confirms previous reports that ZM447439 treatment of human cell lines and Xenopus eggs resulted in loss of phosphorylation of histone H3.15,21 Histone H3 phosphorylation was also inhibited in the human cell line MCF-7 and rat cell line PtK2 after treatment with alternative aurora kinase inhibitors, VX-680 and hesperadin, respectively.17,28 These results indicate that the aurora kinases are indeed inhibited by the aurora kinase inhibitor compounds as histone H3 phosphorylation is a direct downstream target of aurora kinase B. Our results extend these findings, showing that the aurora kinases were inhibited in both cell lines and primary AML samples.
We have shown that cell lines treated with the inhibitors for 48 hours, assessed by size and granularity to be part of the hyperploid population, showed a reduced capacity to undergo clonal growth when re-plated as single cells in fresh medium, indicating that recovery from hyperploidy was impaired. This suggests that the majority of hyperploid cells produced as a result of treatment with AZD1152-HQPA or ZM447439 are not capable of recovering once they have reached a certain stage or DNA content and that they cannot continue to proliferate. This result is in agreement with previous findings that treatment with ZM447439 for 24 hours followed by re-plating in fresh medium without ZM447439 resulted in a dramatic reduction of the number of colonies formed.22 Another report found that continuous treatment with VX-680, which inhibits FLT3 as well as the aurora kinases, completely ablated the colony-forming ability of primary cells from AML patients with FLT3 mutations, although this probably reflects the effect of the agent on proliferation rather than the ability of cells to recover from exposure to the treatment agent once it has been removed.17
Other studies have also shown that the effect of inhibiting the action of aurora kinases is reversible. The phosphorylation of histone H3 was restored within 30 minutes after removal of hesperadin from PtK2 cells.28 When SU6668, which inhibits aurora kinase A amongst other kinases, was washed out of HeLa cells, the cells were able to re-enter the G1 phase. Phosphorylation of histone H3 on serine 10, thought to be a measure for aurora kinase activity, was also completely abolished by the action of SU6668 but recommenced within 30 minutes of removal of this inhibitor.30 These findings suggest that targeting aurora kinases may prove challenging in the setting of clinical hematology as the inhibitors may have to be given at frequent intervals or even continuously to maintain their effect. The aurora kinase inhibitor AZD1152-HQPA may have potential to treat specific sub-groups of leukemic cells with overexpression of aurora kinase A. In particular, the M3 sub-type of AML may be a specific niche for the action of these inhibitors. However, this study suggests that further investigation of these drugs is warranted, particularly AZD1152-HQPA, which appears more effective than ZM447439 in AML cell lines and primary cells.
The online version of this article contains a supplementary appendix.
EW: principle investigator responsible for the design of the study, data acquisition, analysis, and interpretation, drafting of the manuscript; VW: acquisition, analysis and interpretation of data relating to gene expresssion, reviewing the manuscript; CP: concept and design of the study, interpretation of flow cytometry data and flow cytometry aspects of the study, reviewing the manuscript and approval of the version for publication; AB concept and design of the study, critical revisions of the manuscript and approval of the version to be published; KM: concept and design of study, interpretation of acquired data, drafting, critical review and approval of the final version of the manuscript. The authors reported no potential conflicts of interest.
Received for publication August 22, 2007. Revision received December 3, 2007. Accepted for publication December 14, 2007.
|
|
|---|
This article has been cited by other articles:
![]() |
M. Grundy, C. Seedhouse, S. Shang, J. Richardson, N. Russell, and M. Pallis The FLT3 Internal Tandem Duplication Mutation Is a Secondary Target of the Aurora B Kinase Inhibitor AZD1152-HQPA in Acute Myelogenous Leukemia Cells Mol. Cancer Ther., March 1, 2010; 9(3): 661 - 672. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Boss, J. H. Beijnen, and J. H.M. Schellens Clinical Experience with Aurora Kinase Inhibitors: A Review Oncologist, August 1, 2009; 14(8): 780 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ochi, H. Fujiwara, K. Suemori, T. Azuma, Y. Yakushijin, T. Hato, K. Kuzushima, and M. Yasukawa Aurora-A kinase: a novel target of cellular immunotherapy for leukemia Blood, January 1, 2009; 113(1): 66 - 74. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||