|
|
|||||||
Original Article |
B activation and its in vitro and in vivo activity against multiple myelomaMyeloma Research Group, Department of Clinical Haematology and Bone Marrow Transplantation, Alfred Hospital, Melbourne, Victoria, Australia
Correspondence: Andrew Spencer, Myeloma Research Group, Ground Floor, South Block, William Buckland Centre, Alfred Hospital, Commercial Road Melbourne, Victoria 3004, Australia E-mail:aspencer{at}netspace.net.au
| ABSTRACT |
|---|
|
|
|---|
Design and Methods: Dose responsiveness to azacitidine was determined utilizing a panel of genetically heterogenous human multiple myeloma cell lines. Azacitidine was also tested against primary multiple myeloma cells and in the 5T33MM murine model of systemic myelomatosis. Mechanistic studies included immunoblotting of key apoptosis signaling proteins, analysis of p16 gene methylation status, and characterization of both the interleukin-6 and nuclear factor-
B signaling pathways following azacitidine treatment.
Results: Human myeloma cell lines and primary multiple myeloma cells underwent apoptosis following exposure to clinically achievable concentrations of azacitidine (1 µM–20 µM). Similarly, azacitidine prolonged survival from 24.5 days to 32 days (p=0.001, log rank) in the 5T33MM model. At a mechanistic level azacitidine down-regulated two crucial cell survival pathways in multiple myeloma. First, it inhibited the elaboration of both interleukin-6 receptor-
and interleukin- 6 resulting in the reduced expression of both phospho-STAT3 and Bcl-xl. Secondly, azacitidine inhibited both nuclear factor-
B nuclear translocation and DNA binding in a manner independent of I
B. The kinetics of these azacitidine-induced responses was more consistent with protein synthesis inhibition than with either hypomethylation or another DNA-mediated effect.
Conclusions: Azacitidine rapidly induces apoptosis of multiple myeloma cells, is effective in vivo against multiple myeloma and inhibits two crucial cell survival pathways in this disease. We conclude that azacitidine demonstrates novel and highly relevant anti-myeloma effects and warrants further evaluation in a clinical context.
Key words: multiple myeloma, Stat3, Bcl-XL, SOCS3, nuclear factor kB.
| Introduction |
|---|
|
|
|---|
The underlying pathogenesis of MM and mechanisms of progression are complex and remain poorly understood. 10 What is, however, becoming evident is that certain non-random genetic and epigenetic abnormalities may be associated with particularly poor outcomes in patients managed with either conventional or high-dose chemotherapeutic strategies. Structural karyoptypic abnormalities of chromosome 13 and t(4;14) are well recognized examples of the former.11–14 The role of epigenetic abnormalities in MM is less clear; however, several studies have demonstrated that methylation-mediated silencing of the cell cycle regulatory protein p16 is a common event in MM, occurring in from 19%–61% of cases.15–18 The p16 gene is located at 9p21 and is responsible for the production of a 15.8 kD protein that plays a crucial role in the prevention of cell cycle progression at the G1/S check-point.19 Furthermore, preliminary data support the notion that the silencing of p16 may be not only associated with progression of monoclonal gammopathy of undetermined significance to MM, but in already established MM, is associated with a more proliferative tumor phenotype and shorter survival.17–20 Based on these observations strategies aimed at re-activating expression of the p16 gene may provide a potential therapeutic approach for MM.
Azacitidine (AZA) is a ring analog of the naturally occurring pyrimidine nucleoside, cytidine and was first synthesized over 40 years ago.2 In vitro studies have demonstrated that AZA is not only cytotoxic but that it is also capable of inducing cellular differentiation.22,23 Kiziltepe et al.24 demonstrated that 5-azacitidine induces apoptosis and has synergistic cytotoxicity with borte-zomib and doxorubicin in MM. Furthermore, following incorporation into DNA, AZA is capable of covalently binding to and inhibiting DNA methyltransferase with resultant hypomethylation and transcriptional reactivation of previously silenced genes.21 It is this latter characteristic that has led to revived interest in the therapeutic potential of AZA in the treatment of hematologic malignancies, particularly myelodysplastic syndromes.25,26
In this study we examined the effect of AZA on human myeloma cell lines, primary myeloma cells and in an in vivo model of MM. Significant anti-MM activity via previously undescribed modes of action was observed. These data coupled with the well characterized toxicity profile and track record of AZA in clinical practice provide a strong rationale for the further exploration of AZA as a potential therapeutic agent in MM.
| Design and Methods |
|---|
|
|
|---|
Methyl tetrazolium salt (MTS) assays
MTS assays (Cell Titer 96 Aqueous One Solution Cell Proliferation Assay, Promega) were used to quantify the percentage of metabolically active AZA-treated and untreated cells. Briefly, 20 000 cells per well were plated onto a 96-well plate and AZA, at a range of concentrations (1–10 µM), was added every 24 hours. At various time-points 20 µL of MTS reagent were added and the cells were incubated for a further 4 hours at 37°C. The plates were then read at 490 nm. To determine the impact of caspase inhibition on the activity of AZA, U266 and NCI H929 were treated with AZA 5 µM with or without 10, 50 and 100 µM of one of three different caspase inhibitors; caspase 3/Z-DEVD-FMK, caspase 8/Z-IETD-FMK, caspase 9/Z-LEHD-FMK) or a broad caspase inhibitor/Z-VAD-FMK (Merck Pty Ltd., Darmstadt, Germany) and incubated at 37°C for 24 hours. Cell proliferation was then determined using the MTS assay as described above.
The ability of exogenous interleukin-6 (IL-6) to prevent the killing of AZA-treated U266 was evaluated. U266 cells were treated or not with 5 µM AZA daily up to 96 hours with the addition of either 100 pg/mL or 3 ng/mL IL-6 (R&D Systems, Minneapolis, USA) every 24 hours. Cell proliferation at 24, 48, 72 and 96 hours was measured by the MTS assay and paired protein lysates were prepared for western blot analysis of phosphorylated STAT3 as described below.
To measure the functional role of caspase-3 on cell apoptosis, we transfected NCI H929 and U266 utilizing the SignalSilence(R) Caspase-3 siRNA Kit from Cell Signaling Technology, Inc., USA. Forty-eight hours post-transfection NCI H929 and U266 cells were treated, respectively, with 1 or 5 µM AZA daily for 72 hours and cell death was measured by propidium iodide (PI) staining on a FACS Calibur (Becton Dickinson, San Jose, CA, USA) and analyzed with EXPO 32 software.
Methylation-specific polymerase chain reaction
Genomic DNA was isolated from RPMI 8226 and LP- 1 cells that were treated or not with AZA 5 µM daily for 72 hours. The DNA was isolated using a DNeasy Tissue Kit (Qiagen, Hilden, Germany) as instructed by the manufacturer. The resultant genomic DNA was then bisulphated using a CpGenome Universal DNA Modification Kit (Chemicon, Billerica, USA). The polymerase chain reaction (PCR) was performed under the following conditions: 1 x PCR Buffer, 0.2 mM each of dNTP, 1.5 mM MgCl2, 0.2 µM each of forward and reverse primers, 2.5 U of Platinum Taq DNA Polymerase and 40 ng DNA template. The primers for MSP and unmethylation specific PCR (UMSP) were as follows: forward MSP - p16INK4a: TTATTAGAGGGTGGGGCGGATCGC, reverse MSP-p16INK4a: GACCCCGAAC CG CGACCGTAA, forward UMSP-p16INK4a: TTATTAGAGGGTGGGGTGGATTGT and reverse UMSP-p16INK4a: CAACCCCAAACCACAACCATAA. The MSP-p16INK4a primers generated 150 bp products while the UMSP-p16INK4a generated 151 bp products. Reactions were amplified in a Hybaid PCR machine (Eppendorf, Westbury, USA) and products were run on 2% agarose gel/TBE using a 1 Kb Plus DNA Ladder (Invitrogen Corporation, Carlsbad, USA) as the reference.
Primary myeloma cells
Bone marrow mononuclear cells from patients with advanced, multiply relapsed MM (n=13) were isolated by Ficoll Paque Plus (Amersham Biosciences, Piscataway, USA). Buffy layers containing the mononuclear cells were removed and the red blood cells were lysed using red blood cell lysis buffer (10 mM KHCO3, 150 mM NH4Cl and 0.1 mM EDTA, pH 8.0) for 5 min at 37°C followed by a wash with sterile phosphate-buffered saline (PBS). Cells were then cultured overnight in RPMI 1640 medium supplemented with 10% iron fortified bovine calf serum, 2 mM L-glutamine and 100 U/mL penicillin/streptomycin. The next day aliquots of 5x105 cells were treated with 10 or 20 µM AZA for 48 hours. The cells were then stained with CD45-FITC and CD38-PerCP for 15 min at room temperature, washed with FACS buffer (0.5% FCS/PBS) then fixed on ice with 2% PFA for 20 min. After incubation, cells were washed and then stained with Apo 2.7 PE in permeabilization buffer (0.3% saponin, 1% FCS in PBS) for 20 min on ice. After a final wash in FACS buffer the cells were resuspended in 300 µL of FACS buffer. Samples were studied on a FACS Calibur (Becton Dickinson, San Jose, CA, USA) and analyzed with EXPO 32 software.
Evaluation of in vitro and in vivo activity using the 5T33 cell line and 5T33MM model
5T33 cells were cultured in McCoys medium supplemented with 10% iron fortified bovine calf serum, 2 mM L-glutamine and 100 U/mL penicillin/streptomycin. Subsequently, 20,000 5T33 cells/100 µL complete medium were treated with 5–100 µM AZA for 72 hours and cell proliferation was measured by the MTS assay as described previously. C57BL/KaLwRij mice (8–10 weeks old) were obtained from the Animal Resources Center (Perth, Australia). Animals were housed and treated according to conditions approved by the Alfred Medical Research and Education Precinct (AMREP) animal ethics committee. The murine myeloma 5T33 cell line was a gift from Associate Professor Pamela Sykes, Flinders University, Australia. The 5T33 cells were maintained in McCoys 5A modified medium (Sigma-Aldrich, Sydney, Australia) supplemented with 10% iron fortified fetal bovine serum (JRH Biosciences, Brooklyn, VIC, Australia), 50 U/mL penicillin, 50 µg/mL streptomycin and 2.92 mg/mL glutamine (Invitrogen) at 37°C in 5% carbon dioxide. Prior to inoculation 5T33 cells were washed three times in sterile 0.9% saline for irrigation then resuspended in sterile 0.9% saline for injection and quantification. Each mouse was administered 5x105 5T33 cells via the tail vein. Commencing on day 7 following 5T33 cell transfer, the mice were treated with 1 mg/kg, 3 mg/kg or 10 mg/kg AZA (n = 10 at each dose level) or vehicle (sterile saline, n = 10) on days 7, 9, 11, 13 and 15 by intraperitoneal injection. The mice were monitored daily for signs of hind limb paralysis or cachexia. When mice displayed paraparesis or other obvious signs of disease26 they were immediately killed by carbon dioxide inhalation. Time to euthanasia was determined using the method of Kaplan and Meier.
Annexin-V/PI and cell cycle analyses of AZA-treated human myeloma cell lines
U266, NCI H929, LP-1 and RPMI8226 cells were treated daily with AZA 5 µM for 72 hours and the percentages of apoptotic cells at 24, 48 and 72 hours were determined by flow cytometry using PI and annexin-V staining and compared to those of untreated control cells. The cells were washed with 0.01M PBS (0.0027M KCl and 0.137M NaCl, pH 7.4, at 25°C), resuspended in binding buffer, and then stained with FITC-labeled annexin-V antibody. The cells were incubated for 15 min in the dark, washed with 0.01M PBS, resuspended in binding buffer with PI and then analyzed on a FACScan (Becton Dickinson, San Jose, CA, USA). To evaluate the impact of AZA on cell cycling, 106 cells of each of the four human myeloma cell lines treated or not with AZA 1–5 µM for 24, 48 or 72 hours were pelleted at 8,000 g for 5 min and then resuspended in ethanol-0.01M PBS (70/30 v/v). After 30 min, the cells were pelleted and resuspended in 100 µL lysis buffer (LPR, BD Biosciences) followed immediately by 0.5 µL RNase/PI. The samples were analyzed after 15 min on the FACScan (Becton Dickinson) and the percentages of cells in G0–G1, S and G2+M phases of the cell cycle were analyzed using EXPO 32 software.
Western blotting
Nuclear and cytosolic extracts were isolated using a NE-PER kit (Pierce Biotechnology Rockford, USA). Briefly, 106 cells were pelleted then solubilized in Buffer CER I for 10 min on ice followed by addition of CER II for 1 min, then spun at 8,000g for 5 min at 4°C. The resultant supernatant containing the cytosolic fraction was collected and used or stored at –20°C. Buffer NER was added to the pellet, vortexed and kept on ice. The cells were vortexed a further three times at 10 min intervals then spun at 8,000g for 10 min at 4°C. Supernatant containing the nuclear extract was collected and used immediately or stored at –20°C. Proteins were resolved by SDS-PAGE on 1.5 mm gels and electrotransferred onto a nitrocellulose membrane (Pall). Blots were incubated with antibodies against caspases 3, 8, and 9, PARP, cytochrome c, STAT3, pSTAT3 (Tyr 705), IL6-R
and
-tubulin for 2 hours at room temperature and then with appropriate secondary antibodies linked to horse-radish peroxidase.
All antibodies were purchased from Santa Cruz Biotechnology Inc. USA except caspase 3 and pSTAT3 antibody, which were from Cell Signalling Technology Inc. USA. The blots were subjected to SuperSignal West Pico (Pierce Biotechnology) for 5 min then exposed on CL-Xposure film and developed using a CP100 X-Ray Film Processor (Agfa, Mortsel, Belgium).
Evaluation of IL-6 and IL-6 receptor-
(IL6-R
) elaboration
The concentrations of IL-6 and soluble IL6-R
in U266 conditioned medium following treatment with AZA 5 µM daily for 72 hours were determined at various time-points using enzyme-linked immunosorbent assay (ELISA) kits from Quantikine (R&D Systems) according to the manufacturers instructions. Likewise, soluble IL6- R
levels following treatment with cyclohexamide 20 µg/mL were also measured.
In addition, protein lysates were prepared for western blot analysis to determine whole cell IL6-R
expression as described above. Samples were immediately collected, snap frozen in liquid nitrogen and stored at –80ºC until required. Total RNA from U266 cells treated with AZA for 2, 4, 8, 24, 48 and 72 hours was isolated using RNeasy columns (Qiagen) and cDNA was synthesized using oligo(dT)18 for priming and Sensiscript Reverse Transcriptase (Qiagen) according to manufacturers instructions.
Primers used for real time-PCR were IL6-R
forward primer: 5' AAA GGC TGT GCT CTT GGT GAG 3' and IL6-R
reverse primer: 5' GAA TAC TGG CAC GGC TCC TG 3', β-actin forward primer: 5' GAC AGG ATG CAG AAG GAG ATT ACT 3' and β-actin reverse primer: 5' TGA TCC ACA TCT GCT GGA AGG T 3' as the house-keeping gene. A master mix consisting of Quantifast SYBR green PCR (Qiagen), 1 µM forward primer and 1 µM reverse primer was combined and added to 100 ng cDNA template in a 96-well plate. The PCR was initiated at 95°C for 2 min followed by 95°C for 30 seconds, 55°C for 30 seconds and 68°C for 15 seconds for 40 cycles in a Mastercycler ep realplex (Eppendorf).
Measurement of NF
B nuclear translocation and DNA binding
NCI H929 and U266 cells were treated daily with AZA 5 µM for 72 hours. Nuclear lysates were obtained pre-treatment and at 24, 48 and 72 hours as described previously. Subsequently the level of nuclear p65 was measured using the NoShift Transcription Factor assay kit (Merck) according to the manufacturers instructions. NF-
B luciferase activity in lysates from remaining viable cells (prepared following the manufacturers instructions) were measured and normalized by Renilla luciferase activity using the Dual Luciferase assay system (Promega) on a luminometer. NCI-H929 cells were co-transfected with pNF-
B-Luc (Stratagene, La Jolla, USA) and phRL-SV40 plasmid (Promega) to control for cell number and viability by measurement of the production of Renilla luciferase using Lipofectamine 2000 (Invitrogen). Eighteen hours post-transfection cells were treated with tumor necrosis factor-
50 ng/mL (positive control) or AZA (5 µM or 10 µM) for 24 hours, at which time luciferase activity in cell lysates was measured.
Evaluation of SOCS3 and Bcl-XL
NCI H929 and/or U266 cells were treated daily with AZA 5 µM for up to 72 hours. At various time-points cells were harvested, spun at 8000g for 5 min and then washed in FACS buffer (0.5% [fetal calf serum]FCS/PBS). Cell pellets were resuspended in Fix Buffer (2% paraformaldehyde in 0.01M PBS) and stored at 4°C for a minimum of 4 hours. Antibodies against SOCS3 and Bcl- XL were purchased from Santa Cruz Biotechnology Inc. (USA). Fixed cells were washed twice with FACS buffer before addition of primary antibody diluted in permeabilization buffer (0.1% saponin, 1% FCS in 0.01M PBS) for 30 min at room temperature then washed again in FACS buffer before secondary FITC-conjugated antibody was added for 15 min in the dark. Cells were washed as above and resuspended in 300 µL FACS buffer and studied on a FACS Calibur (Becton Dickinson) and analyzed with EXPO 32 software.
| Results |
|---|
|
|
|---|
5 µM AZA. MSP demonstrated that the p16INK4a gene in both the RPMI 8226 and LP-1 cell lines was hypermethylated (Figure 1B) with evidence of p16INK4a gene demethylation in RPMI 8226 at 48 hours following AZA treatment, consistent with the necessity for AZA incorporation into the DNA of dividing cells prior to DMT inhibition. Interestingly, no evidence of demethylation was observed in the more AZA-sensitive LP-1 cell line, suggesting only a minor role, if any, for demethylation in the observed anti-MM effect; it must, however, be noted that we chose to use p16INK4a as a marker of overall demethylation and more complete analyses are warranted. Clearly, evidence of inhibitory activity within the first 24 hours following AZA treatment confirmed non-methylation- dependent anti-MM activity. Primary MM cells from patients with advanced disease demonstrated approximately 25% apoptosis at 48 hours following AZA treatment (Figure 1C), an effect comparable to that seen with the 5T33 cells in vitro (Figure 1D). Subsequently, C57BL/KaLwRij mice treated with 1, 3 or 10 mg/kg AZA from 7 days following inoculation with syngeneic 5T33 cells demonstrated no evidence of significant drug toxicity but there was also no evidence of any relevant in vivo anti-MM activity at either the 1 or 3 mg/kg dose level (data not shown). In contrast, at 10 mg/kg AZA (Figure 1E) there was a statistically significant prolongation of time to hind limb paralysis- the median time to hind limb paralysis of mice treated with vehicle or AZA was 24.5 days and 32 days, respectively (p=0.001, log rank).
|
|
) from 4 hours after treatment (Figure 3A). Consistent with this, there was a dramatic reduction in shedding of IL-6R
into conditioned medium from as early as 2 hours after-AZA treatment and throughout the 72-hour observation period (p<0.05 at all time points for AZA-treated versus untreated controls, Students t-test) (Figure 3B). Similarly, surface expression of IL-6R
in response to AZA fell over 72 hours to approximately 50% of pre-treatment levels (data not shown). Treatment of U266 with cyclohexamide recapitulated the effect of AZA, suggesting that the observed reduction in IL-6R
may be secondary to the inhibition of protein synthesis (Figure 3C). In support of this hypothesis was the observation that pre-treatment with caspase inhibitors had no impact on the reduction in IL-6R
protein expression (data not shown), confirming that the reduction was not secondary to caspase-mediated cleavage. Finally, quantitative reverse transcriptase-PCR, while demonstrating a modest initial reduction in the levels of IL-6R
transcripts subsequently showed a sustained rise compared to pre-AZA levels despite a persisting reduction in IL- 6R
protein expression (Figure 3D). Importantly, the down-regulation of IL-6R
levels was associated with a reduction in pSTAT3 to undetectable levels within 8 hours with no associated reduction in overall STAT3 protein expression (Figure 3E). Furthermore, in the context of inhibition of STAT3 phosphorylation, there was a progressive decline in Bcl-XL protein expression over the 72-hour observation period (Figure 3F). Finally, consistent with the reduction in IL6 signaling activity, and excluding SOCS3 upregulation as a possible mechanism for the inhibition of IL-6 signaling, there was reduced SOCS3 expression from as early as 4 hours after AZA treatment (Figure 3G).
|
|
B activity and autocrine IL-6 secretion
B represents a family of proteins involved in the transcriptional activation of a wide variety of genes critical to the control of immune function, cellular survival and apoptosis.30 Recent insights into the role of NF
B in a variety of cancers, including MM,32–33 prompted us to hypothesize that AZA may act via modulation of NF
B activation. This was clearly demonstrated in both U266 and NCI H929 cells, as evidenced by marked reductions in p65 nuclear translocation following treatment with AZA 5 µM (Figure 5A), and then confirmed by the use of a reporter gene assay showing AZA-induced inhibition of NF
B DNA binding (Figure 5B). Since growth factors and oncoproteins have been demonstrated, in the majority of cases, to enhance NF
B activation via regulation of I
B kinases (IKK)32 we next sought evidence for modulation of I
B following AZA treatment. Surprisingly we saw no consistent changes in either phosphorylated I
B (pI
B) or total I
B (data not shown) to explain the observed inhibition of NF
B. Indeed, U266 cells showed a modest decrease in the level of pI
B following treatment with AZA 5 µM (median reduction of 17% compared to that of untreated control cells) (data not shown). Finally, evaluation of IL-6, a transcriptional target of NF
B, showed a concomitant reduction in autocrine secretion (Figure 5C) from 24 hours following AZA treatment, consistent with the observed inhibition of NF
B.
|
| Discussion |
|---|
|
|
|---|
Our in vitro data on the action of AZA revealed a range of anti-MM effects. Inhibitory activity was seen within 24 hours of treatment in all human myeloma cell lines tested and was achieved at AZA concentrations well below those safely achievable in vivo with either intravenous or subcutaneous administration schedules.37 These in vitro observations were consistent with the anti- MM activity that AZA demonstrated in vivo despite only modest inhibition of the 5T33 cell line in vitro. The 5T33 model that we utilized is a systemic model of aggressive MM with the unambiguous end-point of hind limb paralysis.38 Using escalating doses of AZA we clearly demonstrated a significant survival advantage from treatment with AZA at a dose of 10 mg/kg daily for 5 days, which produced a 33% prolongation in time to hind limb paralysis when compared to that in vehicle-only treated animals. Importantly, animals were not treated until day 7 after inoculation, at which time established systemic disease is readily demonstrable (data not shown). Furthermore, unlike in clinical practice, in which repeated cycles of therapy are used, we demonstrated a significant anti-MM effect with only a single brief cycle of treatment.
In vitro induction of apoptosis by AZA was clearly evident and occurred predominantly via the intrinsic apoptotic pathway. This is consistent with the recognized cytotoxic activity of AZA and preceded the expected hypomethylating activity of AZA, which was first observed – using the hypermethylated p16 gene as a marker of global demethylation – 48 hours after exposure to AZA. The mechanisms by which AZA induces cytotoxicity are not fully elucidated and may well be cell-type dependent. Studies undertaken in the 1970s led to the hypothesis that the principle mechanism of cytotoxicity was incorporation of AZA into RNA.39 This, in turn, was thought to lead to inhibition of protein synthesis and cell death. Data also suggested that later incorporation into DNA could not only inhibit DNA synthesis but also sensitize cells to the effects of other DNA-damaging drugs.40 More recently it has been shown that 5-aza-2'-deoxycytidine (decitabine) cell killing is dependent on the p53 DNA-damage response pathway and is related to enzyme-DNA adduct formation. 41 Our data, showing a rapid onset of cell killing and activity against both p53-wild type and p53-null human myeloma cell lines (data not shown) excludes the latter pathway as a dominant mechanism in AZA-induced MM cell killing.
IL-6 plays a critical role as an anti-apoptosis inducing agent in MM.42,43 Its effects are mediated by both autocrine and paracrine pathways30,44,45 and a cell surface receptor with two components, the IL-6-specific ligand-binding IL-6R
(gp80) subunit and the signal transducing gp130 subunit.46 STAT3 is a member of the signal transducers and activators of transcription (STAT) family of proteins, is a crucial component of the JAK-STAT signaling cascade and mediates the expression of IL-6 responsive genes following recruitment and phosphorylation by gp130.47–49 Importantly, STAT3 is constitutively over-expressed in about one third of patients with MM, is associated with over-expression of the anti-apoptotic Bcl-2 family member, Bcl-XL, and is thus thought to play a crucial role in mediating drug resistance.30,50 Consistent with this, a variety of strategies that down-regulate STAT3 activity have been shown to enhance the sensitivity of MM cells to drug therapy.51–53 Here we have demonstrated for the first time that AZA inhibits autocrine IL-6 signaling via the down-regulation of both IL-6R
expression and autocrine IL-6 secretion. It is also possible that the reduced shedding of IL-6R
may contribute to inhibition of the IL-6 pathway. Published data from studies on the role of soluble IL-6R
suggest that this receptor not only enhances both the magnitude and duration of IL-6 signaling but also the formation of IL- 6/IL-6R
complexes, which markedly prolonged the half-life of IL-6,46 a factor that assumes potentially greater significance in the context of reduced IL-6 secretion. Importantly, the combination of these effects results in sustained inhibition of STAT3 phosphorylation and subsequently the expression of Bcl-XL. The mechanisms underlying the reduced expression of IL- 6R
are unclear; however, our data demonstrate that the effect is not secondary to either caspase-induced cleavage of IL-6R
or a DNA-dependent reduction in IL- 6R
transcription, as shown by quantitative reverse transcriptase-PCR. In contrast, the rapidity of the effect on IL-6R
protein levels (within 2 hours) and the recapitulation of the impact of AZA on IL-6R
with cyclohexamide treatment supports the hypothesis that the early anti-MM effects seen with AZA may be secondary to incorporation into RNA species with subsequent inhibition of protein synthesis, although this clearly requires further evaluation.
A variety of conventional anti-cancer agents have been demonstrated to up-regulate NF
B activity in solid tumors; this, in turn, potentially abrogates the induction of apoptosis and may contribute to resistance to chemotherapy.54 Furthermore, we recently demonstrated that the tyrosine kinase inhibitor PKC412 induces an up to 6-fold increase in NF
B activity in MM cells.55 In contrast, AZA rapidly induces inhibition of NF
B. Clearly, in view of the latter and the proven efficacy of bortezomib in advanced MM, AZA warrants clinical evaluation for the treatment of MM. Furthermore, its ability to inhibit NF
B suggests that AZA may also have a role in sensitizing MM to other available therapeutic agents. The latter may be achieved via down-regulation of important pro-survival and anti-apoptotic (IL-6, IL- 6R
, Bcl-XL) factors but also by abrogating drug-induced NF
B stress responses as we, and others, have recently demonstrated.55–57 Our data suggest an IKK-independent process; while such processes have been previously postulated, the underlying mechanisms remain to be elucidated.58,59 In conclusion, we report that AZA at clinically relevant concentrations has significant anti- MM activity both in vitro and in vivo. AZA induces pleiotropic effects including the down-regulation of JAK-STAT signaling and inhibition of NF
B. Further investigation of these novel effects is clearly warranted; however, our data already provide sufficient rationale for the clinical evaluation of AZA in MM.
| Acknowledgments |
|---|
| Footnotes |
|---|
TK designed, performed and analyzed the experiments and drafted the manuscript; JS performed the murine experimental procedures; AS conceived the study, analyzed and interpreted the data and prepared the manuscript. The authors reported no potential conflicts of interest.
Received for publication September 17, 2007. Revision received January 14, 2008. Accepted for publication January 31, 2008.
| References |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | TABLE OF CONTENTS | ARCHIVE | SUBSCRIPTIONS |