Haematologica, Vol 94, Issue 10, 1465 doi:10.3324/haematol.2009.011486
Copyright © 2009 by Ferrata Storti Foundation

This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Google Scholar Articles by Barton, J. C. PubMed PubMed Citation Articles by Barton, J. C.

Disorders of Iron Metabolism

HAMP promoter mutation nc.-153C>T in 785 HEIRS Study participants

James C. Barton^1,2, Catherine Leiendecker-Foster³, Honggui Li³, Susie DelRio-LaFreniere³, Ronald T. Acton⁴, John H. Eckfeldt³ for the HEIRS Study

¹ Southern Iron Disorders Center, Birmingham, AL
² Department of Medicine, University of Alabama at Birmingham, Birmingham, AL
³ Department of Laboratory Medicine and Pathology, University of Minnesota, Minneapolis, MN
⁴ Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL, USA

Correspondence: Dr. James C. Barton, Southern Iron Disorders Center. G105, 2022 Brookwood Medical Center Drive, Birmingham, AL 35209, USA. Phone internationale: +1.205.877-2888; Fax international: +1.205.877-2039. E-mail:ironmd{at}dna-mail.com

Island and colleagues recently described a 37-year old French man with HFE p.C282Y homozygosity, severe iron overload (IO), and heterozygosity for the novel hepcidin (HAMP) promoter mutation nc.-153C>T.¹ In vitro nc.-153C>T decreased transcriptional activity of the promoter altered its interleukin-6 (IL-6) responsiveness and prevented binding of SMAD1/5/8/4 protein complex to the bone morphogenetic protein-responsive element (BMP-RE) of HAMP. Thus, nc.-153C>T could decrease hepcidin levels and contribute to IO.¹

In the HEmochromatosis and IRon Overload Screening (HEIRS) Study of 99,711 primary care participants 25-years of age or older,² we used denaturing high-performance liquid chromatography (DHPLC) to analyze the HAMP promoter in a subset of 785 participants.^2,3 We selected 75 HFE p.C282Y homozygotes with the highest transferrin saturation (TS) and serum ferritin (SF) values (high TS/SF), and 75 p.C282Y homozygotes with the lowest TS and SF (low TS/SF).³ We randomly selected 76 p.C282Y homozygotes as controls, including 16 high and 19 low TS/SF participants. We also selected 295 participants without p.C282Y homozygosity (74 non-Hispanic whites, 75 Hispanics, 74 blacks, 72 Asians) with the highest percentile for TS or SF of their respective race/ethnicity groups.³ We selected 299 other participants without regard for TS and SF as controls (75 non-Hispanic whites, 74 Hispanics, 75 blacks, 75 Asians).

DHPLC screening was performed using a Transgenomic WAVE® 3500 HT system and a reverse-phase chromatography column (DNASep® HT). We used these PCR primers: ACATGCCAGACACTCCTGAG (forward) and TTGAGCTTGCTCTGGTGTCT (reverse). All samples that appeared to have a mutation were sequenced in both directions using the same PCR amplicons employed for screening. We numbered intronic mutations from the ATG start of translation.

We did not detect HAMP nc.-153C>T in any of 191 HFE p.C282Y homozygotes. In race/ethnicity groups, we detected HAMP nc.-153C>T (heterozygosity) only in a Hispanic woman in her fifth decade (screening TS/SF 51%/3,180 µg/L). On repeat testing, she had TS/SF 37%/87 µg/L without report of treatment for IO. She also had heterozygosity for HAMP -443 nc.C>T, SLC40A1 c.663T>C (p.V221V), and FTL c.163T>C (p.L55L). She did not have HFE p.C282Y, p.H63D, or other exon 2 HFE mutation detectable by DHPLC. Lee et al. did not detect nc.-153C>T in diverse Americans with primary IO.⁴ Similarly, nc.-153C>T was not detected in 100 French subjects with normal serum iron and hemoglobin measures.¹ Ascertaining any role of nc.-153C>T in causing the TS/SF phenotype in the HEIRS Study participant or her family members was beyond the scope of our study. Evaluating family members of the French patient was not possible.¹

Two highly conserved and sequence-identical BMP-RE at positions -84/-79 and -2,255/-2,250 of the HAMP promoter are critical for basal hepcidin mRNA expression and hepcidin response to BMP-2 and BMP-6^.5 The former BMP-RE is proximal to a STAT-binding site important for hepcidin response to IL-6.⁵ HAMP promoter mutations in areas outside BMP-REs or the STAT-binding site may also contribute to the development of IO. For example, 2 Italian patients with beta-thalassemia trait, hepatitis C, and IO were HAMP –nc.72C>T heterozygotes.⁶ Nonetheless, the frequency of nc.-153C>T is too low in HEIRS Study participants to account for most TS/SF phenotype heterogeneity (regardless of HFE genotype or race/ethnicity). We conclude that routine testing to detect HAMP nc.-153C>T is not indicated in population-based hemochromatosis and IO screening programs in North America.

TOP References

 

1. Island ML, Jouanolle AM, Mosser A, Deugnier Y, David V, Brissot P, et al. A new mutation in the hepcidin promoter impairs its BMP response and contributes to a severe phenotype in HFE related hemochromatosis. Haematologica 2009;94:720–4.[Abstract/Free Full Text]
2. Adams PC, Reboussin DM, Barton JC, McLaren CE, Eckfeldt JH, McLaren GD, et al. Hemochromatosis and iron-overload screening in a racially diverse population. N Engl J Med 2005;352:1769–78.[Abstract/Free Full Text]
3. Wang X, Leiendecker-Foster C, Acton RT, Barton JC, McLaren CE, McLaren GD, et al. Heme carrier protein 1 (HCP1) genetic variants in the Hemochromatosis and Iron Overload Screening (HEIRS) Study participants. Blood Cells Mol Dis 2009;42:150–4.[CrossRef][Web of Science][Medline]
4. Lee PL, Gelbart T, West C, Halloran C, Felitti V, Beutler E. A study of genes that may modulate the expression of hereditary hemochromatosis: transferrin receptor-1, ferroportin, ceruloplasmin, ferritin light and heavy chains, iron regulatory proteins (IRP)-1 and -2, and hepcidin. Blood Cells Mol Dis 2001;27:783–802.[CrossRef][Web of Science][Medline]
5. Casanovas G, Mleczko-Sanecka K, Altamura S, Hentze MW, Muckenthaler MU. Bone morphogenetic protein (BMP)-responsive elements located in the proximal and distal hepcidin promoter are critical for its response to HJV/BMP/SMAD. J Mol Med 2009;87:471–80.[CrossRef][Web of Science][Medline]
6. Valenti L, Pulixi EA, Arosio P, Cremonesi L, Biasiotto G, Dongiovanni P, et al. Relative contribution of iron genes, dysmetabolism and hepatitis C virus (HCV) in the pathogenesis of altered iron regulation in HCV chronic hepatitis. Haematologica 2007;92:1037–42.[Abstract/Free Full Text]

This article has been cited by other articles:

				G. D. McLaren and V. R. Gordeuk Hereditary hemochromatosis: insights from the Hemochromatosis and Iron Overload Screening (HEIRS) Study Hematology, January 1, 2009; 2009(1): 195 - 206. [Abstract] [Full Text] [PDF]

This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Google Scholar Articles by Barton, J. C. PubMed PubMed Citation Articles by Barton, J. C.