Original Article |
1 AP-HP, Service de Génétique et Biochimie hormonale, Hôpital Bichat Claude Bernard, Paris, France, Université Paris Diderot, Paris;
2 Laboratoire de Génétique Moléculaire, Hôpital Pontchaillou, Rennes;
3 INSERM U773, Centre de Recherche Biomédicale Bichat-Beaujon, Université Paris Diderot, Paris;
4 Service de Médecine Interne, Centre Hospitalier Jacques Cœur, Bourges and
5 Service des Maladies du Foie et Centre de Référence des Surcharges Génétiques en Fer, Hôpital Pontchaillou, Rennes, France
Correspondence: Carole Beaumont, INSERM U773, Centre de Recherche Biomédicale Bichat Beaujon CRB3, Université Paris Diderot, site Bichat BP416, 16 Rue Henri Huchard, 75870 Paris cedex 18, France., E-mail:carole.beaumont{at}inserm.fr
|
|
|---|
Design and Methods: We studied 91 probands with hyperferritinemia comprising 25 family cases belonging to families with at least two cases of unexplained hyperferritinemia, and 66 isolated cases. In the families, we also analyzed 30 relatives. Hyperferritinemia was considered as unexplained when transferrin saturation was below 45% and/or serum iron below 25 µmol/L and/or no tissue iron excess was detected, when inflammation had been ruled out and when iron responsive element mutation was absent. We carried out sequencing analysis of the FTL gene coding the L ferritin.
Results: A novel heterozygous p.Thr30Ile mutation in the NH2 terminus of L ferritin subunit was identified in 17 probands out of the cohort. The mutation was shown to cosegregate with hyperferritinemia in all the 10 families studied. No obvious clinical symptom was found associated with the presence of the mutation. This unique mutation is associated with an unusually high percentage of ferritin glycosylation.
Conclusions: This missense mutation of FTL represents a new cause of genetic hyperferritinemia without iron overload. We hypothesized that the mutation increases the efficacy of L ferritin secretion by increasing the hydrophobicity of the N terminal "A"
helix.
Key words: hyperferritinemia, glycosylated ferritin, L ferritin, iron overload.
|
|
|---|
In this paper we report a new mutation located near the NH2 terminus of the L ferritin subunit that cosegregates with hyperferritinemia at the heterozygote state. This unique mutation is associated with an unusually high percentage of ferritin glycosylation and represents a new cause of genetic hyperferritinemia without iron overload.
|
|
|---|
We studied 91 probands with hyperferritinemia comprising 25 family cases belonging to families with at least two cases of unexplained hyperferritinemia, and 66 isolated cases. In the families, we also analyzed 30 relatives. Out of these 121 subjects, there were 36 women and 85 males, aged from eight to 83 years. None of the subjects was homozygous for the p.Cys282Tyr mutation of the HFE gene. Hyperferritinemia was considered as unexplained when transferrin saturation was below 45% and/or serum iron below 25 µmol/L, and when inflammation had been ruled out.
From the 66 isolated patients without family history who had unexplained hyperferritinemia, 47 of them had genetic testing for ferroportin (methods as previously described)9 and no mutation was found. Metabolic syndrome and inflammation were not considered responsible for hyperferritinemia on the basis of bio-clinical evaluation. Twenty-seven of them had liver iron (LIC) content evaluation by MRI or liver biopsy. Twenty-four patients had normal or mildly elevated LIC (<100 µmol/g dry liver weight, normal values <36) 3 patients had elevated LIC (120, 140 and 210 µmol/g) but these values were considered to not fully account for their plasma ferritin concentration (1800, 2000 and 760 µg/L respectively).
Although some of the patients were referred to us for the presence of early onset cataract, none of them had IRE mutation in the L ferritin exon 1. Informed consent was obtained for all patients.
Our control population consisted of 528 DNA samples prepared from the lymphocytes of healthy patients with normal iron status. These persons had given their informed written consent for the study of iron metabolism genes after approval of the protocol by the local ethical committee (98/35–197).
Sequencing of the L ferritin
The promoter, the four exons and three introns of the FTL gene were sequenced on both strands using an ABI sequencing kit on ABI 3130 sequencer (Applied Biosystem). The primers used for amplification were previously described for exon 19 and were as follows for the other exons: exon 2 (forward, 2F: 5-GGTAAACAGAGGGCGGAGTC, reverse, 2R: 5-GACACCTAC GCCCTCAAATC); exon 3 (forward, 3F: 5-AACGACTCTTGGGAAATGTAGG, reverse, 3R: 5-AGGTGTGAAATGAGGCTCTGA); exon 4 (forward, 4F: 5-CATTTTAATCTGCAACTGGCT G, reverse, 4R: 5-GAGGGAGAGGCTTAGGCAGA). Amplification of intron 1 was obtained with primers 1F and 2R, intron 2 with primers 2F and 3R, and intron 3 with primers 3F and 4R) 1Kb of the promoter was amplified with the following primers: the proximal promoter with (forward 5-AACACCTCACAGCCTTCCAA, reverse 5-TCTGTTCCGTCCAAACACTG) and the distal promoter with (forward 5-CTTCTCTTTGTGGGCCTGAA, reverse 5-CGCTGCGAGATAAGGAGTCT).
Genotyping for the p.Thr30Ile mutation was performed using a Taqman assay Custom by design (Applied Biosystem). PCR amplification was carried out using the following primer pair:
forward: CCGCCCTAGCCACGTC, reverse: GCGCAGCTGGAGGAAATTAG and allelic discrimination was achieved using two allele specific probes:VIC:CCTCCTACACCTACCTC for the wild type allele and FAM:CCTCCTACATCTACCTC for the mutated allele. Real time PCR was performed on an ABI 7500 instrument (Applied Biosystem).
Measurement of ferritin glycosylation
Glycosylated ferritin was determined according to the method of Worwood et al. with minor modifications.10 Serum was incubated for two hours at room temperature with Concanavalin A Sepharose 4B on a roller mixer. The sample was then centrifuged at 3000 rpm for 15 min and unbound ferritin was recovered in the supernatant and assayed using an immunoassay (DadeBehring). Glycosylated ferritin was obtained from the difference between total ferritin and unbound ferritin.
|
|
|---|
=0.
![]() View larger version (20K): [in a new window] [Download PPT slide] |
Figure 1. Family trees of 10 probands with hyperglycosylated serum ferritin. Families are numbered F1 to F10. Black symbols denote the presence of both hyperferritinemia and the heterozygous FTL mutation (p.Thr30Ile). The half-filled black symbols denote hyperferritinemia but no information on the FTL sequence. A question mark in the symbols indicates that the value of serum ferritin and the genotype are unknown. The genotype is indicated as p.Thr30Ile for the presence of the heterozygous FTL mutation, wild type (w.t.) for the normal sequence and a question mark for absence of genotyping. Serum ferritin values (Ft) are indicated in µg/L. The probands are indicated with an arrow.
|
This p.Thr30Ile mutation has never been reported in the literature and was not found in 528 individuals of our control population. The threonine at position 30 of the L ferritin subunit is situated in the A
helix, nearest the N terminus of the molecule (Figure 2A). It is highly conserved throughout evolution in L subunits while the homologous amino acid residue in H subunits of most mammalian species is a valine.
![]() View larger version (33K): [in a new window] [Download PPT slide] |
Figure 2. Position of the Thr30 in the L ferritin subunit crystal model and consequences of the mutation on the hydrophobicity of the N terminus. (A) Position of the Thr30 in the L ferritin crystal and details of its environment. Aminoacid residues Thr 30 is on the A helix, Trp90 is on the loop between the B and the C helices (B-C loop) and Leu 103 is on helix C. The glycosylated Asn is also indicated. The crystallographic data of L ferritin subunit from reference 18 were analyzed using the Pymol software. (B) Hydrophobicity cluster analysis of the A helix in the wild type L and the p.Thre30Ile mutant L ferritin subunits was carried out using the HCA software.23 (http://bioserv.rpbs.jussieu.fr/RPBS/cgi-bin/Ressource.cgi?chzn_lg=fr&chzn_rsrc=HCA). The replacement of the threonine residue by isoleucine at position 30 extends the hydrophobic cluster (hydrophobic residues are indicated in green and the hydrophobic cluster is encircled).
|
Interestingly, serum ferritin glycosylation was evaluated in proband II2, in Family 1 and found to be close to 100%. Hyperglycosylation ranging from 90–99% was subsequently found in 8 individuals carrying the p.Thr30Ile mutations for whom serum was available for testing. The usual range of ferritin glycosylation is between 50% and 80%11 except for patients with Stills disease who display much lower percentages of glycosylated ferritin (<20%).12 In patients with HHCS, ferritin glycosylation has not been extensively measured but in one family, 3 individuals with the same IRE mutation were found to have 10–30% glycosylated ferritin (Beaumont C. et al., unpublished data, 2008).
|
|
|---|
In HHCS, the high serum ferritin levels reflect an increased synthesis of the L ferritin subunit in tissues, as shown by increased ferritin contents found in lymphoblastoid cell lines14 and in the lens15 of HHCS patients. On the contrary, EBV transformed cells from patients with the Thr30Ile variant had normal ferritin content (data not shown). Only a few mutations have been described in the FTL coding sequence. Dominantly inherited late-onset basal ganglia disease has been described resulting from frameshift mutations. These result in modifications of the C-terminal part of the molecules and are thought to affect protein folding and stability.16 Rare variants have been found, one in a patient with Parkinson disease (His133Pro) and one in 2 normal controls (Lys 54 Arg) whose possible functional consequences have not been explored.17 From three dimensional models of the assembled 24-mer ferritin molecule, it is likely that the FTL mutation that we describe here has little impact on the structure of the polymer. Indeed, the side chain of the mutated threonine is located on the external surface of the A alpha helix18 facing the rather hydrophobic residues Tryptophane 90 on the BC loop and Leucine 130 on helix C of the BC loop (Figure 2A). Furthermore, the homologous residue on the H subunit from many species is a valine. Accordingly, the mutated subunits probably do not alter the ferritin function in keeping with the observation that the carriers of the mutation do not present any specific symptoms.
An interesting feature is the very high percentage of glycosylated ferritin in subjects with hyperferritinemia and the Thr30Ile variant. Serum ferritin is thought to result from the secretion of a small fraction of cellular ferritin through the classical secretory pathway. Indeed, serum ferritin consists mostly in L ferritin subunits N-linked glycosylated in the Golgi apparatus (called G subunits)19,20 and the L ferritin subunit has a consensus glycosylation site (NYST) with the asparagine (N) at position 8 of the polypeptide chain. However, L ferritin lacks a typical amino-terminal, hydrophobic signal sequence and the mechanism by which it enters the secretory pathway is not known. It has been shown in rat hepatocytes that cytosolic L ferritin is targeted to the secretion pathway during translation despite the absence of conventional signal sequence.21 In this respect, a similar example is that of Plasminogen Activator Inhibitor type 2 (PAI-2) that also exists in two forms: a non-glycosylated cytoplasmic form and a glycosylated extracellular form. This dual localization was shown to result from a relatively inefficient routing into the secretory pathway. Like L ferritin, PAI-2 has no classical signal peptide and the secretion signal consists of 2 mildly hydrophobic sequences near the N terminal of the polypeptide.22 Interestingly, when this signal was made more hydrophobic by site directed mutagenesis, the secretion of PAI-2 became more efficient.22 The A helix of the L ferritin subunit may play a similar role in addressing a fraction of the molecules to the endoplasmic reticulum during translation of the mRNA. Interestingly, the A alpha helix of L ferritin has a higher hydrophobicity than the homologous helix of the H subunit that is not secreted and the substitution of the polar threonine at position 30 of L ferritin by a hydrophobic isoleucine increases the hydrophobicity of this helix (Figure 2B). Therefore, we suggest that the Thr30Ile amino acid change that we report here modifies a signal sequence resulting in an increase of ferritin secretion. The observed high level of glycosylation may simply reflect the enhanced proportion of mutated serum ferritin that is secreted as compared to the fraction that is released via cell lysis. From a practical point of view, identification of a novel genetic cause of high serum ferritin in the absence of iron overload may prevent unnecessary investigations and sometimes detrimental treatments in subjects with this form of unexplained hyperferritinemia.
CK and AMJ co-ordinated the study, analyzed data and wrote the paper. GH identified the first mutation, AM, DH and EBJ performed sequencing and analyzed data, FM performed cell culture experiments. MM, YD and PB diagnosed patients and analyzed data. BG and CB initiated the study, analyzed data and wrote the paper. All the authors approved the final version to be published.
The authors reported no potential conflicts of interest.
Received for publication September 8, 2008. Revision received November 20, 2008. Accepted for publication November 21, 2008.
|
|
|---|
Related Article
This article has been cited by other articles:
![]() |
C. Camaschella and E. Poggiali Towards explaining "unexplained hyperferritinemia" Haematologica, March 1, 2009; 94(3): 307 - 309. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||