Acute Leukemia |
1 Hospices Civils de Lyon, Centre Hospitalier Lyon Sud, Laboratory for molecular biology and UMR5239 CNRS, Pierre-Bénite
2 Service de Cytogénétique Médicale, CHU de Clermont-Ferrand
3 EA3846, Faculté de Médecine, Clermont-Ferrand and Hematology (Biology) CHU de Clermont-Ferrand
4 Hopital Edouard Herriot, Hematology department, Lyon
5 Hematology CHU de Clermont-Ferrand, France
Correspondence: Sandrine Hayette, PhD, Laboratory for molecular biology and UMR5239 CNRS, CHLS 165, Ch du grand Revoyet, 69 495 Pierre Bénite, France. Phone: international +33.4.78864107. Fax: international +33.4.78864104. E-mail:sandrine.hayette{at}chu-lyon.fr
Key words: BCR-ABL mutation, tyrosine kinase inhibitors, dasatinib.
Although targeted inhibition of BCR-ABL by imatinib (IM) is an effective therapy for patients with Philadelphia chromosome-positive leukemias, a minority of patients, most of them in advanced phase, acquire mutations in the BCR-ABL kinase domain (KD) leading to relapse.1–5 These mutations consist, almost exclusively, in single nucleotide (nt) substitutions. Rare cases of splicing events inducing deletion or insertion of multiple nucleotides into ABL KD have been described. A deletion of 27 amino acids (aa) induced by the L248V mutation activating a cryptic splice site has been identified6 as well as cases resulting from the insertion of 35 nt from intron 8 leading to a frameshift.7,8 In the latter, this insertion could account for up to 62% of IM-resistant CML patients in chronic phase.8 Here, we describe a novel mutation acquired at the moment of the IM resistance, consisting in an insertion of 12nt, and leading to the conservation of the open reading frame (ORF).
The 57-year old female patient was diagnosed in July 2006 with bi-phenotypic acute leukemia (hyperleukocytosis at 48 G/L with 47% of blasts exhibiting myeloid and lymphoid features: CD13+, CD33+, CD19+, CD10+ and CD22+). The procedures followed were in accordance with the Helsinki Declaration as revised in 2008. A karyotypic analysis demonstrated a t(9;22)(q34;q11) as sole anomaly and molecular analysis detected M-BCR-ABL transcript. Hyper C-VAD and IM at 800 mg/day were used as induction regimen leading to complete remission. Consolidation therapy with alternating high-dose methotrexate plus cytarabine and Hyper C-VAD plus IM were given. She achieved a complete hematologic remission, a complete cytogenetic response and a major molecular response (BCR-ABL/ABL IS 0.06%). In April 2007, as she didnt have any HLA-matched donor she underwent high-dose therapy with cyclophosphamide plus total body irradiation (12Gy) conditioning regimen followed by the autologous transplantation of G-CSF collected PBSC. As the BCR-ABL/ABL IS rose to 0.09% IM was reintroduced at 600 mg/day leading to a sustained drop of the transcript level to 0.035% six months later (Figure 1). Then the transcript ratio rose rapidly within three months (0.7%; 2.4%; 8.1%). A mutation screen performed in April 2008 revealed an insertion of 12nt in 100% of the BCR-ABL transcripts and no other mutation. This mutation induced the insertion of 4 aa (A, F, G and S) between I293 and K294 (Figure 2). Retrospective analyses revealed that the mutation could be detected by a sensitive RQ-PCR on the cDNA five months before relapse, even while the patient experienced a molecular response (BCR-ABL/ABL IS at 0.035%). The proportion of the mutated clone in the setting of minimal residual disease assessed by nested PCR-RFLP analysis was 100% at this time (Figure 1). Comparison of this 12nt with those in the human data bank revealed its presence in many genomic regions but none into ABL (9q34) or BCR genes. Unfortunately, the small length of this sequence does not make it possible to deduce its genomic origin. Despite this, this insertion does not seem to be a constitutional polymorphism because it was present at the genomic level in DNA extracted from leukemic cells but was missing in genomic DNA extracted from the genotpically distinct patients epithelial mouth cells. Moreover, retrospective analysis by sensitive specific RQ-PCR on the cDNA from the patient did not detect any mutated clone either in previous samples from December 2007 nor at the time of diagnosis which definitively excludes constitutional polymorphism and suggests that the mutational mechanism was induced or selected by IM therapy. Usually, alternative splicing events give rise to mixed spliceoforms at mRNA levels and were often due to punctual mutations inducing cryptic splice sites6 but in this case all BCR-ABL transcripts carried only the insertion as sole anomaly and the screening for other genomic mutations performed by sequencing amplified PCR fragments 307nt upstream and 225nt downstream of the insertion did not show any other mutation. The increase of IM up to 800mg/day during six weeks led to the loss of hematologic response whereas molecular monitoring performed monthly after dasatinib introduction (70 mg twice a day one month later) showed a strong reduction of the BCR-ABL/ABL ratio to 0.7, 0.2, 0.07, 0.01 and 0.007%, respectively.
![]() View larger version (36K): [in a new window] [Download PPT slide] |
Figure 1. Quantification of BCR-ABL transcripts and mutated transcripts follow-up with time. Reverse transcription (RT) and quantitative real time-PCR (RQ-PCR) to quantify BCR-ABL fusion transcript and ABL control gene were performed according to the ELN recommendations.9,10 The mutation was detected by direct sequencing (on both strands) from the relapsed patients sample. It was quantified by RQ-PCR from available cDNA samples and from genomic DNA extracted from the patients epithelial mouth cells or from the patients leukemic cells at the time of relapse with a fluorescent probe (UPL N#10, Roche diagnostics) and a reverse allele specific oligonucleotide: TTTGGACCCAAAAGCAATCT. The forward primers used were: CCGTGAAGACCTTGAAGGAG and GCACATGCAAGCCAGCTTTG for cDNA and gDNA, respectively. A serial 10-fold dilution series of mutated cDNA from the relapse sample (ranging from 106 to 101 copies) was amplified and the assay was found to be linear over at least five orders of magnitude (slope –3.41, intercept 36.61). Assessment of the proportion of the mutated transcripts was performed by quantification of the specific bands from each NlaIV digested fragments by restriction fragment length polymorphism (RFLP) analysis as previously described.11,12 Red lines with squares represent the levels of total BCR-ABL transcripts expressed as BCR-ABL ratios in % according to the international scale (log red scale, left hand side). Blue lines show the BCR-ABL mutated transcripts expressed in % of total BCR-ABL transcripts (linear blue scale, right hand side).11
|
![]() View larger version (27K): [in a new window] [Download PPT slide] |
Figure 2. Sequence of the mutated transcripts. Upper reading frame: primary sequence data of the 12 nucleotide insertion mutation with the corresponding red sequences in nucleotides and amino acids. Amino acid numbers from ABL Ia isoform (Genbank accession n. NM_005157). Lower reading frame: wild type sequence. Black indicates guanine (G); blue, cytosine (C); red, thymidine (T); and green, adenosine (A).
|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||