4th Palermo Conference on INNOVATIVE THERAPIES FOR LYMPHOID MALIGNANCIES
Haematologica, Vol 94, Issue 9, 1324-1326 doi:10.3324/haematol.2009.007864
Copyright © 2009 by Ferrata Storti Foundation
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayette, S.
Right arrow Articles by Tournilhac, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayette, S.
Right arrow Articles by Tournilhac, O.

Acute Leukemia

Detection of twelve nucleotides insertion in the BCR-ABL kinase domain in an imatinib-resistant but dasatinib-sensitive patient with bi-phenotypic acute leukemia

Sandrine Hayette1, Kaddour Chabane1, Andrei Tchirkov2, Marc G. Berger3, Franck E. Nicolini4, Olivier Tournilhac5

1 Hospices Civils de Lyon, Centre Hospitalier Lyon Sud, Laboratory for molecular biology and UMR5239 CNRS, Pierre-Bénite
2 Service de Cytogénétique Médicale, CHU de Clermont-Ferrand
3 EA3846, Faculté de Médecine, Clermont-Ferrand and Hematology (Biology) CHU de Clermont-Ferrand
4 Hopital Edouard Herriot, Hematology department, Lyon
5 Hematology CHU de Clermont-Ferrand, France

Correspondence: Sandrine Hayette, PhD, Laboratory for molecular biology and UMR5239 CNRS, CHLS 165, Ch du grand Revoyet, 69 495 Pierre Bénite, France. Phone: international +33.4.78864107. Fax: international +33.4.78864104. E-mail:sandrine.hayette{at}chu-lyon.fr

Key words: BCR-ABL mutation, tyrosine kinase inhibitors, dasatinib.

Although targeted inhibition of BCR-ABL by imatinib (IM) is an effective therapy for patients with Philadelphia chromosome-positive leukemias, a minority of patients, most of them in advanced phase, acquire mutations in the BCR-ABL kinase domain (KD) leading to relapse.15 These mutations consist, almost exclusively, in single nucleotide (nt) substitutions. Rare cases of splicing events inducing deletion or insertion of multiple nucleotides into ABL KD have been described. A deletion of 27 amino acids (aa) induced by the L248V mutation activating a cryptic splice site has been identified6 as well as cases resulting from the insertion of 35 nt from intron 8 leading to a frameshift.7,8 In the latter, this insertion could account for up to 62% of IM-resistant CML patients in chronic phase.8 Here, we describe a novel mutation acquired at the moment of the IM resistance, consisting in an insertion of 12nt, and leading to the conservation of the open reading frame (ORF).

The 57-year old female patient was diagnosed in July 2006 with bi-phenotypic acute leukemia (hyperleukocytosis at 48 G/L with 47% of blasts exhibiting myeloid and lymphoid features: CD13+, CD33+, CD19+, CD10+ and CD22+). The procedures followed were in accordance with the Helsinki Declaration as revised in 2008. A karyotypic analysis demonstrated a t(9;22)(q34;q11) as sole anomaly and molecular analysis detected M-BCR-ABL transcript. Hyper C-VAD and IM at 800 mg/day were used as induction regimen leading to complete remission. Consolidation therapy with alternating high-dose methotrexate plus cytarabine and Hyper C-VAD plus IM were given. She achieved a complete hematologic remission, a complete cytogenetic response and a major molecular response (BCR-ABL/ABL IS 0.06%). In April 2007, as she didn’t have any HLA-matched donor she underwent high-dose therapy with cyclophosphamide plus total body irradiation (12Gy) conditioning regimen followed by the autologous transplantation of G-CSF collected PBSC. As the BCR-ABL/ABL IS rose to 0.09% IM was reintroduced at 600 mg/day leading to a sustained drop of the transcript level to 0.035% six months later (Figure 1). Then the transcript ratio rose rapidly within three months (0.7%; 2.4%; 8.1%). A mutation screen performed in April 2008 revealed an insertion of 12nt in 100% of the BCR-ABL transcripts and no other mutation. This mutation induced the insertion of 4 aa (A, F, G and S) between I293 and K294 (Figure 2). Retrospective analyses revealed that the mutation could be detected by a sensitive RQ-PCR on the cDNA five months before relapse, even while the patient experienced a molecular response (BCR-ABL/ABL IS at 0.035%). The proportion of the mutated clone in the setting of minimal residual disease assessed by nested PCR-RFLP analysis was 100% at this time (Figure 1). Comparison of this 12nt with those in the human data bank revealed its presence in many genomic regions but none into ABL (9q34) or BCR genes. Unfortunately, the small length of this sequence does not make it possible to deduce its genomic origin. Despite this, this insertion does not seem to be a constitutional polymorphism because it was present at the genomic level in DNA extracted from leukemic cells but was missing in genomic DNA extracted from the genotpically distinct patient’s epithelial mouth cells. Moreover, retrospective analysis by sensitive specific RQ-PCR on the cDNA from the patient did not detect any mutated clone either in previous samples from December 2007 nor at the time of diagnosis which definitively excludes constitutional polymorphism and suggests that the mutational mechanism was induced or selected by IM therapy. Usually, alternative splicing events give rise to mixed spliceoforms at mRNA levels and were often due to punctual mutations inducing cryptic splice sites6 but in this case all BCR-ABL transcripts carried only the insertion as sole anomaly and the screening for other genomic mutations performed by sequencing amplified PCR fragments 307nt upstream and 225nt downstream of the insertion did not show any other mutation. The increase of IM up to 800mg/day during six weeks led to the loss of hematologic response whereas molecular monitoring performed monthly after dasatinib introduction (70 mg twice a day one month later) showed a strong reduction of the BCR-ABL/ABL ratio to 0.7, 0.2, 0.07, 0.01 and 0.007%, respectively.


Figure 10941324
View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Quantification of BCR-ABL transcripts and mutated transcripts follow-up with time. Reverse transcription (RT) and quantitative real time-PCR (RQ-PCR) to quantify BCR-ABL fusion transcript and ABL control gene were performed according to the ELN recommendations.9,10 The mutation was detected by direct sequencing (on both strands) from the relapsed patient’s sample. It was quantified by RQ-PCR from available cDNA samples and from genomic DNA extracted from the patient’s epithelial mouth cells or from the patient’s leukemic cells at the time of relapse with a fluorescent probe (UPL N#10, Roche diagnostics) and a reverse allele specific oligonucleotide: TTTGGACCCAAAAGCAATCT. The forward primers used were: CCGTGAAGACCTTGAAGGAG and GCACATGCAAGCCAGCTTTG for cDNA and gDNA, respectively. A serial 10-fold dilution series of mutated cDNA from the relapse sample (ranging from 106 to 101 copies) was amplified and the assay was found to be linear over at least five orders of magnitude (slope –3.41, intercept 36.61). Assessment of the proportion of the mutated transcripts was performed by quantification of the specific bands from each NlaIV digested fragments by restriction fragment length polymorphism (RFLP) analysis as previously described.11,12 Red lines with squares represent the levels of total BCR-ABL transcripts expressed as BCR-ABL ratios in % according to the international scale (log red scale, left hand side). Blue lines show the BCR-ABL mutated transcripts expressed in % of total BCR-ABL transcripts (linear blue scale, right hand side).11


Figure 20941324
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Sequence of the mutated transcripts. Upper reading frame: primary sequence data of the 12 nucleotide insertion mutation with the corresponding red sequences in nucleotides and amino acids. Amino acid numbers from ABL Ia isoform (Genbank accession n. NM_005157). Lower reading frame: wild type sequence. Black indicates guanine (G); blue, cytosine (C); red, thymidine (T); and green, adenosine (A).

In view of these results, this insertion which correlated with IM resistance was not a polymorphism and must be induced by an unknown recombination mechanism rather than alternative splicing events. We would like to underline that the mutation is highly sensitive to dasatinib and we strongly suggest that it requires the introduction of second generation TKIs.


arrow
Footnotes
 
Funding: this study was supported by research fundings from the Fondation de France, Associations Laurette Fugain and Guillaume Espoir to SH, KC and FEN.


arrow
References
 
  1. Branford S, Rudzki Z, Walsh S, Parkinson I, Grigg A, Szer J, et al. Detection of BCR-ABL mutations in patients with CML treated with imatinib is virtually always accompanied by clinical resistance, and mutations in the ATP phosphate-binding loop (P-loop) are associated with a poor prognosis. Blood 2003;102:276-83.[Abstract/Free Full Text]
  2. Ernst T, Erben P, Muller MC, Paschka P, Schenk T, Hoffmann J, et al. Dynamics of BCR-ABL mutated clones prior to hematologic or cytogenetic resistance to imatinib. Haematologica 2008;93:186-92.[Abstract/Free Full Text]
  3. Jabbour E, Kantarjian H, Jones D, Talpaz M, Bekele N, O’Brien S, et al. Frequency and clinical significance of BCR-ABL mutations in patients with chronic myeloid leukemia treated with imatinib mesylate. Leukemia 2006;20:1767-73.[CrossRef][Web of Science][Medline]
  4. Soverini S, Martinelli G, Rosti G, Bassi S, Amabile M, Poerio A, et al. ABL mutations in late chronic phase chronic myeloid leukemia patients with up-front cytogenetic resistance to imatinib are associated with a greater likelihood of progression to blast crisis and shorter survival: a study by the GIMEMA Working Party on Chronic Myeloid Leukemia. J Clin Oncol 2005;23:4100-9.[Abstract/Free Full Text]
  5. Nicolini FE, Corm S, Le QH, Sorel N, Hayette S, Bories D, et al. Mutation status and clinical outcome of 89 imatinib mesylate-resistant chronic myelogenous leukemia patients: a retrospective analysis from the French intergroup of CML (Fi(phi)-LMC GROUP). Leukemia 2006;20:1061-6.[CrossRef][Web of Science][Medline]
  6. Gruber FX, Hjorth-Hansen H, Mikkola I, Stenke L, Johansen T. A novel Bcr-Abl splice isoform is associated with the L248V mutation in CML patients with acquired resistance to imatinib. Leukemia 2006;20:2057-60.[CrossRef][Web of Science][Medline]
  7. Laudadio J, Deininger MW, Mauro MJ, Druker BJ, Press RD. An intron-derived insertion/truncation mutation in the BCR-ABL kinase domain in chronic myeloid leukemia patients undergoing kinase inhibitor therapy. J Mol Diagn 2008;10:177-80.[Abstract/Free Full Text]
  8. Lee TS, Ma W, Zhang X, Giles F, Cortes J, Kantarjian H, et al. BCR-ABL alternative splicing as a common mechanism for imatinib resistance: evidence from molecular dynamics simulations. Mol Cancer Ther 2008;7:3834-41.[Abstract/Free Full Text]
  9. Gabert J, Beillard E, van der Velden VH, Bi W, Grimwade D, Pallisgaard N, et al. Standardization and quality control studies of ‘real-time’ quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - a Europe Against Cancer program. Leukemia 2003;17:2318-57.[CrossRef][Web of Science][Medline]
  10. Hughes T, Deininger M, Hochhaus A, Branford S, Radich J, Kaeda J, et al. Monitoring CML patients responding to treatment with tyrosine kinase inhibitors: review and recommendations for harmonizing current methodology for detecting BCR-ABL transcripts and kinase domain mutations and for expressing results. Blood 2006;108:28-37.[Abstract/Free Full Text]
  11. Hayette S, Michallet M, Baille ML, Magaud JP, Nicolini FE. Assessment and follow-up of the proportion of T315I mutant BCR-ABL transcripts can guide appropriate therapeutic decision making in CML patients. Leuk Res 2005;29:1073-7.[CrossRef][Web of Science][Medline]
  12. Nicolini FE, Hayette S, Corm S, Bachy E, Bories D, Tulliez M, et al. Clinical outcome of 27 imatinib mesylate-resistant chronic myelogenous leukemia patients harboring a T315I BCR-ABL mutation. Haematologica 2007;92:1238-41.[Abstract/Free Full Text]




This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayette, S.
Right arrow Articles by Tournilhac, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayette, S.
Right arrow Articles by Tournilhac, O.