Island and colleagues recently described a 37-year old French man with HFE p.C282Y homozygosity, severe iron overload (IO), and heterozygosity for the novel hepcidin (HAMP) promoter mutation nc.-153C>T.1 In vitro nc.-153C>T decreased transcriptional activity of the promoter altered its interleukin-6 (IL-6) responsiveness and prevented binding of SMAD1/5/8/4 protein complex to the bone morphogenetic protein-responsive element (BMP-RE) of HAMP. Thus, nc.-153C>T could decrease hepcidin levels and contribute to IO.1

In the HEmochromatosis and IRon Overload Screening (HEIRS) Study of 99,711 primary care participants 25-years of age or older,2 we used denaturing high-performance liquid chromatography (DHPLC) to analyze the HAMP promoter in a subset of 785 participants.2,3 We selected 75 HFE p.C282Y homozygotes with the highest transferrin saturation (TS) and serum ferritin (SF) values (high TS/SF), and 75 p.C282Y homozygotes with the lowest TS and SF (low TS/SF).3 We randomly selected 76 p.C282Y homozygotes as controls, including 16 high and 19 low TS/SF participants. We also selected 295 participants without p.C282Y homozygosity (74 non-Hispanic whites, 75 Hispanics, 74 blacks, 72 Asians) with the highest percentile for TS or SF of their respective race/ethnicity groups.3 We selected 299 other participants without regard for TS and SF as controls (75 non-Hispanic whites, 74 Hispanics, 75 blacks, 75 Asians).

DHPLC screening was performed using a Transgenomic WAVE® 3500 HT system and a reverse-phase chromatography column (DNASep® HT). We used these PCR primers: ACATGCCAGACACTCCTGAG (forward) and TTGAGCTTGCTCTGGTGTCT (reverse). All samples that appeared to have a mutation were sequenced in both directions using the same PCR amplicons employed for screening. We numbered intronic mutations from the ATG start of translation.

We did not detect HAMP nc.-153C>T in any of 191 HFE p.C282Y homozygotes. In race/ethnicity groups, we detected HAMP nc.-153C>T (heterozygosity) only in a Hispanic woman in her fifth decade (screening TS/SF 51%/3,180 μg/L). On repeat testing, she had TS/SF 37%/87 μg/L without report of treatment for IO. She also had heterozygosity for HAMP -443 nc.C>T, SLC40A1 c.663T>C (p.V221V), and FTL c.163T>C (p.L55L). She did not have HFE p.C282Y, p.H63D, or other exon 2 HFE mutation detectable by DHPLC. Lee et al. did not detect nc.-153C>T in diverse Americans with primary IO.4 Similarly, nc.-153C>T was not detected in 100 French subjects with normal serum iron and hemoglobin measures.1 Ascertaining any role of nc.-153C>T in causing the TS/SF phenotype in the HEIRS Study participant or her family members was beyond the scope of our study. Evaluating family members of the French patient was not possible.1

Two highly conserved and sequence-identical BMP-RE at positions -84/-79 and -2,255/-2,250 of the HAMP promoter are critical for basal hepcidin mRNA expression and hepcidin response to BMP-2 and BMP-6^.5 The former BMP-RE is proximal to a STAT-binding site important for hepcidin response to IL-6.5 HAMP promoter mutations in areas outside BMP-REs or the STAT-binding site may also contribute to the development of IO. For example, 2 Italian patients with beta-thalassemia trait, hepatitis C, and IO were HAMP –nc.72C>T heterozygotes.6 Nonetheless, the frequency of nc.-153C>T is too low in HEIRS Study participants to account for most TS/SF phenotype heterogeneity (regardless of HFE genotype or race/ethnicity). We conclude that routine testing to detect HAMP nc.-153C>T is not indicated in population-based hemochromatosis and IO screening programs in North America.

• Copyright© Ferrata Storti Foundation